Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA050472 Similarity: 0.992 Similarity: 0.992 Similarity: 0.991
UTR: 5HSAA050472
Gene: HOMER1
MFE: -5.242
ENS: 0.738
Length: 45.
Predicted Ligands:
SAM - 10/20
preQ_1 - 10/20

 RS: URS00021EDEB0_12908
MFE: -6.092
Ligand: SAM
Species: unclassified sequences SAM-SAH-Weickhmann-2018 RNA
 RS: URS00021EDC21_12908
MFE: -6.092
Ligand: SAM
Species: unclassified sequences SAM-SAH-Weickhmann-2018 RNA
 RS: URS00021EDF99_12908
MFE: -9.542
Ligand: SAM
Species: unclassified sequences SAM-SAH-Weickhmann-2018 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA050472 URS00021EDEB0_12908 URS00021EDC21_12908 URS00021EDF99_12908
Length 45. 45. 45. 44.
Similarity - 0.992 0.992 0.991
Ensemble Norm 0.738 - - -
MFE -5.242 -6.092 -6.092 -9.542
Ligands - SAM SAM SAM
Gene HOMER1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.008 2.008 2.007
Length SE - 0. 0. 1.
Lev Distance - 10. 10. 11.
UBS 2. 3. 3. 2.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 0.
ILR 1. 1. 1. 1.
H 1. 1. 1. 1.
BL 0. 1. 1. 1.
BR 0. 0. 0. 0.
UN 0.356 0.267 0.267 0.273

Sequences

Field Description
UTR seq + 25 gcaaguuuucauugggcaaaATGGGGGAACAACCTATCTTCAGCA
UTR dot + 25 ……………((…(((((…….)))))…..)).
RS 1 seq AACUUAUAACGGCUACCUGAAGUAAGUUUUUUUAUAAACGGAGCA
RS 1 dot ………..(((.((….(((((….)))))….))))).
RS 2 seq AACUUAUAACGGCUACCUGAAGUAAGUUUUUUUAUAAAUGGAGCA
RS 2 dot ………..(((.((….(((((….)))))….))))).
RS 3 seq UGACUGCAACGGCUUCCUGAAGCAGUUUACACUUCAUUGGAGCA
RS 3 dot ………..(((((.(((((………)))))..))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table