Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA050570 Similarity: 0.990 Similarity: 0.990 Similarity: 0.988
UTR: 5HSAA050570
Gene: HOXA4
MFE: -7.668
ENS: 0.989
Length: 72.
Predicted Ligands:
2'-dG-II - 7/20
purine - 5/20
fluoride - 4/20
RS: URS0000D69259_768704
MFE: -14.135
Ligand: purine
Species: Desulfosporosinus meridiei DSM 13257 Purine riboswitch
RS: URS0000D66287_768710
MFE: -14.335
Ligand: purine
Species: Desulfosporosinus youngiae DSM 17734 Purine riboswitch
RS: URS000080E171_1423
MFE: -16.684
Ligand: purine
Species: Adenosine RIboswitch from Bacillus subtilis (PDB 3LA5, chain A)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA050570 URS0000D69259_768704 URS0000D66287_768710 URS000080E171_1423
Length 72. 72. 72. 71.
Similarity - 0.990 0.990 0.988
Ensemble Norm 0.989 - - -
MFE -7.668 -14.135 -14.335 -16.684
Ligands - purine purine purine
Gene HOXA4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.007 3.007 3.004
Length SE - 0. 0. 1.
Lev Distance - 13. 13. 14.
UBS 3. 3. 3. 3.
BS 0. 0. 0. 0.
ILL 1. 0. 0. 0.
ILR 0. 1. 1. 1.
H 2. 2. 2. 2.
BL 0. 1. 1. 1.
BR 0. 0. 0. 0.
UN 0.292 0.375 0.375 0.225

Sequences

Field Description
UTR seq + 25 aaaacgacaacgcgagaaaaauuaguauuuuugcacuucacaaauuaATGACCATGAGCTCGTTTTTGATAA
UTR dot + 25 ………..(((((((………)))))))……((((..(((((……..)))))))))….
RS 1 seq UUCUUGUAUAAGCUCAAUAAUAUGGUUUGAGCGUCUCGACCAGGCAACCAUAAAUUGCCCAGGCUACAUGAA
RS 1 dot ………..((((((………))))))…….((.(((((…….)))))..))………
RS 2 seq UUCUUGUAUAAGCUCAUUAAUAUGGUGUGAGCGUUUCGACCAGGCAACCAUAAAUUGCCCAGGCUACAUGAA
RS 2 dot ………..((((((………))))))…….((.(((((…….)))))..))………
RS 3 seq GGCUUCAUAUAAUCCGAAUGAUAUGGUUUCGGAGCUUCCACCAAGAGCCUUAAACUCUUGACUAUGGAGUC
RS 3 dot …………((((((………))))))..(((((.((((((…….))))))….)))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table