Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA050571 Similarity: 0.982 Similarity: 0.980 Similarity: 0.980
UTR: 5HSAA050571
Gene: HOXA5
MFE: -9.884
ENS: 0.992
Length: 86.
Predicted Ligands:
glycine - 12/20
guanidine - 3/20
cobalamin - 2/20
 RS: URS0000AB7530_525246
MFE: -26.866
Ligand: SAM
Species: Actinomyces urogenitalis DSM 15434 SAM riboswitch (S box leader)
 RS: URS0000D894BC_1917485
MFE: -24.081
Ligand: glycine
Species: Sulfitobacter sp. AM1-D1 Glycine riboswitch
 RS: URS0000B9235B_1519096
MFE: -25.559
Ligand: glycine
Species: Aquimixticola soesokkakensis Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA050571 URS0000AB7530_525246 URS0000D894BC_1917485 URS0000B9235B_1519096
Length 86. 85. 86. 85.
Similarity - 0.982 0.980 0.980
Ensemble Norm 0.992 - - -
MFE -9.884 -26.866 -24.081 -25.559
Ligands - SAM glycine glycine
Gene HOXA5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.013 11.014 10.003
Length SE - 1. 0. 1.
Lev Distance - 22. 23. 23.
UBS 5. 5. 6. 7.
BS 0. 0. 0. 0.
ILL 3. 2. 5. 3.
ILR 2. 1. 4. 4.
H 2. 1. 1. 3.
BL 0. 1. 0. 0.
BR 1. 2. 0. 0.
UN 0.163 0.047 0.047 0.106

Sequences

Field Description
UTR seq + 25 gggugcuauagacgcacaaacgaccgcgagccacaaaucaagcacacauaucaaaaaacaaATGAGCTCTTATTTTGTAAACTCAT
UTR dot + 25 ..((((…….))))……….(((..(((((…(((…(((…………))).)))…..)))))…)))..
RS 1 seq CAUCCAUCCAGAGCGGCUGAGAGACCUGGCUCUAUGACGCCGCAGCAACCCUCACGCGGGGUGCUUCCGCCAGGAUCGAUGGAGA
RS 1 dot ..((((((…………..((((((((……((.((((…………)))).))……)))))).))))))))..
RS 2 seq GCAUCCGUCACGGGAGAAUCGGAUCAUCCGAUGCCGAAGGAGCAACCGCCCCGGAAACUCUCAGGCACAGGGACCGUGCAGGAUAU
RS 2 dot ..((((..(((((………….(((..((((…((((…(((…)))…))))..))))…))))))))..))))..
RS 3 seq CAGCCCGCGUUGGGAGAACUGGUCACCAGUGCCGAAGGAGCAACCGCCCCGGUAAACUCUCAGGCAAAUGGACCUUCGCGGCACC
RS 3 dot …(((…..)))…..(((…)))((((((((((..((…(((..((……))..)))…))..)))))..))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table