Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA050572 Similarity: 0.967 Similarity: 0.965 Similarity: 0.960
UTR: 5HSAA050572
Gene: HOXA7
MFE: -34.393
ENS: 0.994
Length: 157.
Predicted Ligands:
cobalamin - 8/20
glucosamine - 5/20
Mg2+ - 3/20
 RS: URS0002330387_1170562
MFE: -33.501
Ligand: cobalamin
Species: Calothrix sp. PCC 6303 Cobalamin riboswitch
 RS: URS0002327137_317936
MFE: -35.538
Ligand: cobalamin
Species: Nostoc sp. PCC 7107 Cobalamin riboswitch
 RS: URS0000C2C2A6_1128398
MFE: -35.235
Ligand: Mg2+
Species: [Clostridium] acidurici 9a M-box riboswitch (ykoK leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA050572 URS0002330387_1170562 URS0002327137_317936 URS0000C2C2A6_1128398
Length 157. 158. 159. 160.
Similarity - 0.967 0.965 0.960
Ensemble Norm 0.994 - - -
MFE -34.393 -33.501 -35.538 -35.235
Ligands - cobalamin cobalamin Mg2+
Gene HOXA7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.001 3.005 3.
Length SE - 1. 4. 9.
Lev Distance - 42. 41. 40.
UBS 9. 9. 8. 8.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 3.
ILR 2. 2. 2. 2.
H 3. 4. 3. 3.
BL 2. 3. 3. 1.
BR 3. 2. 3. 3.
UN 0.204 0.228 0.277 0.219

Sequences

Field Description
UTR seq + 25 gugcugcggcgagcuccguccaaaagaaaaugggguuugguguaaaucuggggguguaauguuaucauauaucacucuaccucguaaaaccgacacugaaagcugccggacaacaaaucacaggucaaaauuATGAGTTCTTCGTATTATGTGAACG
UTR dot + 25 ….((((.((((((((((……….)))))))))).))))……(((((((((((….))).)).))))))..(((((((….(((.(((…..((……..))…..))))))….)))))))………………..
RS 1 seq AGCAUUCACCUUAAUCUCGGUUCUAGUGAGUAUCAUCCACUAGAGGUAACGGGGAAAGUCCGGUGUAAGUCCGGCGCUGUCCCGCAGCUGUAAUCAAGGAAAAAAAGAAAAAUAUUAACCUUGUCAGUCAGAAUGCCCGCCGAUAAGUCAAAACAACC
RS 1 dot ……..((……..))((((((((.(……)))))))))……((((.(((((((…….)))).))).))))(((.(((….(((((……………….)))))…..)))..)))………………….
RS 2 seq AUAAUAAACAGAAUAUUCGGUUUUGGUGGAGAUCAGCCACCAAAGGUAACGGGGAAAGUUCGGUGGAAAUCCGGCACUGUCCCGCAACUGUGAAGGAAAGACAAAAAACUGAAAAUUAACUUUCCAAGUCAGGAUGCCCGCCGAAGUAUACUAAUAAGU
RS 2 dot ………………(.(((((((((…….))))))))).)….((((.(((((((…….)))).))).))))(((.(((….((((((……………….))))))….)))..)))………………….
RS 3 seq AUAUUUCCUCGGUAGGUGAGGUUACUACAAGGAUACGGGUUGCUGCCGUAAAAGGAUGGAGACAUUCUGAACUGGUUAGCAGGUUUUGCCGAACAAAGAAGGCUUAAUCUAACGCAACUUCAUUGCCUUGCAGAGCUAAAACUUGAACGAGAUAAAAUGG
RS 3 dot …..((((..((((………)))).))))……(((((((((….((((((….))))))….)))).)))))(((((((….(((.((((…………….)))).)))….)))))))……………………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table