Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA050586 Similarity: 0.983 Similarity: 0.982 Similarity: 0.982
UTR: 5HSAA050586
Gene: HOXB5
MFE: -7.999
ENS: 0.990
Length: 84.
Predicted Ligands:
zmp-ztp - 12/20
SAM - 4/20
cyclic-di-GMP - 3/20
 RS: URS0000C86C15_1262699
MFE: -14.224
Ligand: zmp-ztp
Species: Anaerostipes sp. CAG:276 ZMP/ZTP riboswitch
 RS: URS0000AB6F9B_525318
MFE: -16.751
Ligand: SAM
Species: Lactobacillus buchneri ATCC 11577 SMK box translational riboswitch (SAM-III)
 RS: URS0000AB58D5_525310
MFE: -17.199
Ligand: SAM
Species: Lactobacillus brevis subsp. gravesensis ATCC 27305 SMK box translational riboswitch (SAM-III)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA050586 URS0000C86C15_1262699 URS0000AB6F9B_525318 URS0000AB58D5_525310
Length 84. 85. 83. 83.
Similarity - 0.983 0.982 0.982
Ensemble Norm 0.990 - - -
MFE -7.999 -14.224 -16.751 -17.199
Ligands - zmp-ztp SAM SAM
Gene HOXB5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.004 1. 1.002
Length SE - 1. 1. 1.
Lev Distance - 20. 23. 23.
UBS 2. 4. 3. 3.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 1.
ILR 1. 1. 1. 1.
H 1. 2. 1. 1.
BL 0. 0. 0. 0.
BR 0. 0. 0. 0.
UN 0.345 0.282 0.325 0.301

Sequences

Field Description
UTR seq + 25 gugaagcacaggguuauaacgaccacgauccacaaaucaagcccuccaaaaucacccaaATGAGCTCGTACTTTGTAAACTCCT
UTR dot + 25 ((((…..((((((……………………))))))……))))………………………..
RS 1 seq CAUAAGUCAUAUGACUGACGGACAAGUGGAGUUUACCACAGGAAGUAUGACAACGAAUUUUUAGCCGACCGUCUGGGCACCCUGC
RS 1 dot …..(((((((..((………((((……))))))…)))))))…………(((………)))…….
RS 2 seq GUAGGUUAUGAGUUCCCGAUAGGAUUCACGCCAGACGUGAAGAAGCCUUGUAACCUAAAAAAUAUAUAGGGGGAAAUAAAAUG
RS 2 dot .((((((((((((((………((((((…..)))))))))..)))))))))))……………………..
RS 3 seq UUAGGUUAUGAGUUCCCGAUAGGAUUCACGCCAGACGUGAAGAAGCCUUGUAACCUAAAAAAUAUAUAGGGGGAAAUAAAAUG
RS 3 dot (((((((((((((((………((((((…..)))))))))..))))))))))))…………………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table