Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA050591 Similarity: 0.965 Similarity: 0.964 Similarity: 0.963
UTR: 5HSAA050591
Gene: HOXB7
MFE: -18.796
ENS: 0.997
Length: 128.
Predicted Ligands:
cobalamin - 14/20
TPP - 2/20
FMN - 2/20
 RS: URS0002334A41_1338011
MFE: -22.533
Ligand: cobalamin
Species: Elizabethkingia anophelis NUHP1 Cobalamin riboswitch
 RS: URS000231DC50_1801611
MFE: -18.531
Ligand: cobalamin
Species: Candidatus Melainabacteria bacterium RIFOXYA2_FULL_32_9 Cobalamin riboswitch
 RS: URS0000C10783_284581
MFE: -35.
Ligand: SAM
Species: Bacillus koreensis SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA050591 URS0002334A41_1338011 URS000231DC50_1801611 URS0000C10783_284581
Length 128. 128. 127. 127.
Similarity - 0.965 0.964 0.963
Ensemble Norm 0.997 - - -
MFE -18.796 -22.533 -18.531 -35.
Ligands - cobalamin cobalamin SAM
Gene HOXB7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.024 7.080 14.001
Length SE - 0. 1. 1.
Lev Distance - 45. 45. 44.
UBS 7. 7. 7. 9.
BS 0. 0. 0. 0.
ILL 2. 4. 2. 3.
ILR 1. 2. 2. 3.
H 2. 1. 1. 1.
BL 2. 1. 3. 4.
BR 2. 1. 4. 2.
UN 0.031 0.188 0.315 0.

Sequences

Field Description
UTR seq + 25 gguccuuuuugguguaaaucuggacucuaauucuguaauauaucaaggaaucucguaaaaccgacacuaaaacgucccugccuacaaaucauccggccaaauuATGAGTTCATTGTATTATGCGAATA
UTR dot + 25 (((((…………….)))))…(((((((((((…(((.(((.(((((((..(((…………………………)))…..)))))))))).)))))))))).)))).
RS 1 seq UAUUUUAAUAUUCUUAUUUUUGCAUUCGAAUUUUCGAAAAGGUGAAUCGUGUGCAAUUCACGAACUGUCGCGCAACUGUGUAUGUCCUUCGACAUGAGUCAGAUCCCUGAAAAUUCGGUAAAUACUUU
RS 1 dot ………………(((((…(((((((((….((((((.((((((……..((((…..((((….))))……)))))))))).)))….)))))))))))))))))……
RS 2 seq ACUAGUAAUAUAAAAACAAAUUCAAUAAGUACAAAUUGGGAAAUUCGGUGUAAAUCCGAAGCUGUGCCGCAACUGUAUUGAUUCAAUGAAUCUAAGCCAGGAUACCAAUUUGUAUGAAGCUCUUACU
RS 2 dot ……………………….(((((((((((…(((((((…..((.(((.(.((((…….)))).).)))…))……))).)))).)))))))))))…………
RS 3 seq CUCUUAUCCCGAGCUGGUGGAGGGACAGGCCCUAUGAAACCCAGCAACCAUCACCAUACUUUAUAUUUUUUUACUUGGUGAUAAGGUGCUAACCUGAUGCAAGGGGAAAGCCCUUGAUCGAUAAGAG
RS 3 dot ((((((((…….(((.(((((.(…((((.((……(((.((((((((((……………….)))))))..))))))………)).))))…)))))).)))))))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table