Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA050596 Similarity: 0.988 Similarity: 0.987 Similarity: 0.987
UTR: 5HSAA050596
Gene: HOXC11
MFE: -12.087
ENS: 0.999
Length: 52.
Predicted Ligands:
glutamine - 10/20
unknown - 9/20
homocysteine - 1/20
 RS: URS0000E6035A_401562
MFE: -19.262
Ligand: unknown
Species: Aurantimonas ureilytica sul1 RNA
 RS: URS0000D68FF7_981327
MFE: -11.818
Ligand: unknown
Species: Acinetobacter lwoffii NCTC 5866 = CIP 64.10 = NIPH 512 nhaA-I RNA
 RS: URS0000D698CD_1144665
MFE: -12.431
Ligand: unknown
Species: Acinetobacter sp. CIP 102136 nhaA-I RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA050596 URS0000E6035A_401562 URS0000D68FF7_981327 URS0000D698CD_1144665
Length 52. 53. 51. 51.
Similarity - 0.988 0.987 0.987
Ensemble Norm 0.999 - - -
MFE -12.087 -19.262 -11.818 -12.431
Ligands - unknown unknown unknown
Gene HOXC11 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.009 10.002 2.003
Length SE - 1. 1. 1.
Lev Distance - 14. 13. 16.
UBS 4. 5. 4. 4.
BS 0. 0. 0. 0.
ILL 2. 2. 3. 2.
ILR 2. 1. 0. 1.
H 1. 1. 1. 1.
BL 1. 2. 0. 1.
BR 0. 1. 2. 1.
UN 0.154 0.057 0.196 0.098

Sequences

Field Description
UTR seq + 25 auccggagccggcaggagaggagaacgATGTTTAACTCGGTCAACCTGGGCA
UTR dot + 25 …….(((..((((.(((..((((…))))..)))……))))))).
RS 1 seq UUUGGACCCGUUCGAUCGGGUGGCUACGCUGGGCGCCGAUCCCCCGGCCAACU
RS 1 dot .((((..(((…((((.((((.(((…))).))))))))…)))))))..
RS 2 seq GGGUGUCUAGCGUAGCUAAGACAGGUAUUCGUUAUAGUCGGGCCGCUAUAA
RS 2 dot …….(((((..(((..(((..(((…..))).))).))))))))…
RS 3 seq GGGUGUCUAGCUGAGCUAAGGCAGGUAUUUGUUGUAGUCGGGCCGCUAUAA
RS 3 dot .((((….(((..((((.(((((….))))).))))..)))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table