Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA050599 Similarity: 0.975 Similarity: 0.975 Similarity: 0.970
UTR: 5HSAA050599
Gene: HOXC9
MFE: -25.617
ENS: 0.992
Length: 121.
Predicted Ligands:
FMN - 6/20
SAM - 4/20
methionine - 4/20
 RS: URS0002329114_1797513
MFE: -21.438
Ligand: cobalamin
Species: Candidatus Blackburnbacteria bacterium RIFCSPHIGHO2_01_FULL_43_15b Cobalamin riboswitch
 RS: URS0000C45151_408170
MFE: -27.193
Ligand: Ni/Co
Species: human gut metagenome NiCo riboswitch
 RS: URS0000AB287F_351627
MFE: -39.154
Ligand: SAM
Species: Caldicellulosiruptor saccharolyticus DSM 8903 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA050599 URS0002329114_1797513 URS0000C45151_408170 URS0000AB287F_351627
Length 121. 120. 121. 122.
Similarity - 0.975 0.975 0.970
Ensemble Norm 0.992 - - -
MFE -25.617 -21.438 -27.193 -39.154
Ligands - cobalamin Ni/Co SAM
Gene HOXC9 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9. 6.006 6.010
Length SE - 1. 0. 1.
Lev Distance - 29. 32. 37.
UBS 6. 8. 8. 8.
BS 0. 0. 0. 0.
ILL 1. 3. 1. 1.
ILR 1. 2. 0. 1.
H 2. 2. 3. 3.
BL 3. 3. 3. 3.
BR 2. 2. 2. 3.
UN 0.240 0.258 0.165 0.139

Sequences

Field Description
UTR seq + 25 uggaaaaauaauuaccugacuugauuguucugugagcagauaaaaaguacauauacaguucauacaauaaucuuauguauguaaaaccccguuacgATGTCGGCGACGGGGCCCATCAGTA
UTR dot + 25 …………(((.(((…(((((((.(((((((………………..))))))).)))))))))).)))…….(((((((.((….))..)))))))……….
RS 1 seq GUAUGUUGUCAAAGAGAUUGUGCUAAAGGAAGCAGGUGUAACUCCUGCACUGUGCCGCAACCGUAAUCCUGAGCGUAGUCGAAGGAAAGUCGGAAAACUAGCAAUCCAAGAAUCCCGAGC
RS 1 dot ……………(((((((((..((((.((.(((……..(((……..))))))))..)))).)))))))))…(((..((.((….)).))..)))………….
RS 2 seq ACAGUACAAACUGAGCAGACCGGGAUUAUCGUAUAUAACGAUUAUUAAUGAAGCUUAUUAUAUAAUCCUGGAGUCGGGUCACACGCGUGACAGUGGAAUCUUUUCUAUCCACGGGACAGUA
RS 2 dot ……….((((.(…((((((((((.(((.(((((………….).))))))))))))))))).)))))(((((….))))).(((((……….)))))………
RS 3 seq UUCUUAUCAAGAGUGGUGGAGGGACUGGCCCAAUGAAGCCCGGCAACCGGAAAAAGGUAUGGGUGCCCUUUUUCUUGGUGCCAAUUCCAGCAGGUAUUUUUAAAAUACCUGGCAGAUAAGAA
RS 3 dot …((((((….)))))).((((.((((((((.((((…((((.(((……….))).))))…)))))))).)))).))))..(((((((((…)))))))))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table