Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA050600 Similarity: 0.983 Similarity: 0.979 Similarity: 0.979
UTR: 5HSAA050600
Gene: HOXC9_0
MFE: -21.218
ENS: 0.995
Length: 95.
Predicted Ligands:
Ni/Co - 15/20
SAM - 2/20
tetrahydrofolate - 1/20
 RS: URS000232B9ED_525309
MFE: -28.981
Ligand: tetrahydrofolate
Species: Lactobacillus antri DSM 16041 THF riboswitch
 RS: URS0000C196C6_408170
MFE: -33.081
Ligand: Ni/Co
Species: human gut metagenome NiCo riboswitch
 RS: URS0000D6A5D8_313596
MFE: -22.183
Ligand: SAM
Species: Robiginitalea biformata HTCC2501 SAM-I/IV variant riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA050600 URS000232B9ED_525309 URS0000C196C6_408170 URS0000D6A5D8_313596
Length 95. 95. 95. 94.
Similarity - 0.983 0.979 0.979
Ensemble Norm 0.995 - - -
MFE -21.218 -28.981 -33.081 -22.183
Ligands - tetrahydrofolate Ni/Co SAM
Gene HOXC9 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 4.003 1.002
Length SE - 0. 0. 1.
Lev Distance - 21. 27. 27.
UBS 5. 4. 6. 6.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 2. 0. 1. 2.
H 3. 3. 4. 3.
BL 2. 1. 2. 2.
BR 0. 0. 1. 0.
UN 0.232 0.232 0.179 0.277

Sequences

Field Description
UTR seq + 25 guucugugagcagauaaaaaguacauauacaguucauacaauaaucuuauguauguaaaaccccguuacgATGTCGGCGACGGGGCCCATCAGTA
UTR dot + 25 ..((((….))))…….((((((((.((………….))..))))))))…(((((((.((….))..)))))))……….
RS 1 seq GUUGGGGUAGGAACUCCAGAGUUAUUGUCCAGCGGAACGGAAUGUGAACGCUGGAAGGAGGCCGCAGGGCUGCUUUGGUUUUCCGCAUUCACCAC
RS 1 dot .(((((((….)))))))……..(((((((…………..))))))).((((((((.(((….)))))))))))…………
RS 2 seq ACAGUACAAACUGAGCAGGCAAUGUCUGUAAAUGACAUGAAGCCGGGCCGUCGAGACGGCAGCAGAUGGGUAUCAGGCGCAUCUGUGGGACAGUA
RS 2 dot .((((….))))….(((.(((((…….)))))…)))..(((((….))))).(((((((.((…..)).)))))))………
RS 3 seq UUCCUGCAUCAGGAACGCUAAGGCGCGUACCAACCGAGCAUAAAAGCCACGGUGGUUCAGAAUGCGGACGGUCGUCAAAAAAAUAAUUCCUUUC
RS 3 dot ((((((…))))))……..((((((((.((((.((……))..)))))))…..)))))(((….)))………………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table