Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA050664 Similarity: 0.990 Similarity: 0.990 Similarity: 0.990
UTR: 5HSAA050664
Gene: HPD
MFE: -15.116
ENS: 0.876
Length: 65.
Predicted Ligands:
unknown - 13/20
fluoride - 5/20
glutamine - 2/20
 RS: URS0000D6591D_1156918
MFE: -21.546
Ligand: unknown
Species: Alcaligenes faecalis subsp. faecalis NCIB 8687 nhaA-I
 RS: URS0000D6977C_12908
MFE: -21.430
Ligand: unknown
Species: unclassified sequences nhaA-I RNA
 RS: URS0000E5FDB1_1797840
MFE: -21.486
Ligand: unknown
Species: Deltaproteobacteria bacterium RBG_16_49_23 nhaA-I RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA050664 URS0000D6591D_1156918 URS0000D6977C_12908 URS0000E5FDB1_1797840
Length 65. 65. 65. 64.
Similarity - 0.990 0.990 0.990
Ensemble Norm 0.876 - - -
MFE -15.116 -21.546 -21.430 -21.486
Ligands - unknown unknown unknown
Gene HPD - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 0. 0.001 0.
Length SE - 0. 0. 1.
Lev Distance - 13. 14. 13.
UBS 2. 2. 2. 2.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 0.
H 2. 2. 2. 2.
BL 0. 0. 0. 0.
BR 0. 0. 0. 0.
UN 0.262 0.262 0.231 0.250

Sequences

Field Description
UTR seq + 25 aggccucuagucccaguaggagguuugacuaagaucaaucATGGGCTTTGAACCTCTAGCCTACA
UTR dot + 25 ((((((((……….))))))))……………((((((……….))))))..
RS 1 seq GGGUGUUUUGCUGGCAUGGUGCAGCAGGGCAGGUUAAAUGCUUACGCAGGGUCGGGCCGCCUUGU
RS 1 dot …((((((((((……..))))))))))…………..(((((((……)))))))
RS 2 seq GGGUCCAGAGAUAUGUCCUGUUAUUUCUGGAGGUUAAGAAGAUCGGAUAGUCGGGCCGCUAUCUG
RS 2 dot …((((((((((……..))))))))))…………((((((((……))))))))
RS 3 seq GGGUCCAGAGAUAUGUCCUGUUAUUUCUGGAGGUUAAGAAGGUUGGAUAGCCGGGCCGCUAUCU
RS 3 dot …((((((((((……..))))))))))………….(((((((……)))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table