Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA050863 Similarity: 0.974 Similarity: 0.973 Similarity: 0.973
UTR: 5HSAA050863
Gene: HSBP1
MFE: -29.207
ENS: 0.843
Length: 114.
Predicted Ligands:
TPP - 11/20
glycine - 3/20
SAM - 2/20
 RS: URS0000C6230A_1128398
MFE: -29.867
Ligand: SAM
Species: [Clostridium] acidurici 9a SAM riboswitch (S box leader)
 RS: URS0000ABBEC1_697281
MFE: -38.946
Ligand: cobalamin
Species: Mahella australiensis 50-1 BON Cobalamin riboswitch
 RS: URS0000BFCB44_1287182
MFE: -41.202
Ligand: TPP
Species: Mesorhizobium sp. L48C026A00 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA050863 URS0000C6230A_1128398 URS0000ABBEC1_697281 URS0000BFCB44_1287182
Length 114. 114. 115. 115.
Similarity - 0.974 0.973 0.973
Ensemble Norm 0.843 - - -
MFE -29.207 -29.867 -38.946 -41.202
Ligands - SAM cobalamin TPP
Gene HSBP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.004 4.008 6.004
Length SE - 0. 1. 1.
Lev Distance - 30. 33. 33.
UBS 10. 9. 9. 9.
BS 0. 0. 0. 0.
ILL 5. 3. 4. 5.
ILR 5. 3. 4. 5.
H 2. 2. 2. 2.
BL 2. 3. 3. 0.
BR 2. 3. 2. 1.
UN 0.149 0.088 0.061 0.087

Sequences

Field Description
UTR seq + 25 cgagaagcagcggcccggggcgacugagcggacaaacggaaguguagguuacggucugagacaucaccgccaagcugggcaucggggagATGGCCGAGACTGACCCCAAGACCG
UTR dot + 25 …….(((..(((…)))..)))……….(((…((..(((..((((((..(.((((.(((((……)))….))..)))).)..))))))))).))…)))
RS 1 seq AACUCAUCGAGAGAGAUUGAGGGAACUGGCCCAAUGAAAUCCGGCAACCGAGCUUGUGCUAAGGUGCUAAAUCCAGCGGUAUAGCCAAAAAAAUUGGUAUCCGGAAGAUGAGGG
RS 1 dot ..((((((……))).)))……..(((…….(((((..(((((..(((.((((.(.((((……)))).).)))))))…..)))))..)))))……)))
RS 2 seq GGGAAGCCGGUGAGAAGCCGGCGCGGUGCCGCCACUGUAUGGCAGAGUAUGCUGCAUAUGCCACUGAAGUAUUUCGGGAAGGCGCAGCAAAGCGAUGAUGCCGAGCCAGGAUACC
RS 2 dot …..((((((…..))))))..((((…((…((.(((((..((.((((((….(((.(((((….)))))…)))))))))…..))..))))).))..)).))))
RS 3 seq AGUUUACGCCCGANGUCCCGGCAAGGGGCUGAGAUACUGCUGGCUUACGCGGCGCAGUGACCCGUUGAACCUGAUCCAGUUCAUACUGGCGUAGGGACGGUGCAAGCGCUUUGCG
RS 3 dot …….((((..((((((…..))))))..)……..)))…((((((((..((..(((((…((((..(((((….)))))..)))))))))..)).)))))..)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table