Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA051002 Similarity: 0.972 Similarity: 0.971 Similarity: 0.971
UTR: 5HSAA051002
Gene: HSD17B7
MFE: -40.631
ENS: 0.997
Length: 120.
Predicted Ligands:
SAM - 11/20
TPP - 2/20
cobalamin - 2/20
 RS: URS0000D948CE_1798267
MFE: -43.388
Ligand: SAM
Species: Gammaproteobacteria bacterium RBG_16_66_13 SAM riboswitch (S box leader)
 RS: URS0000C071AF_1736462
MFE: -57.089
Ligand: Mn2+
Species: Brevundimonas sp. Root1423 yybP-ykoY manganese riboswitch
 RS: URS00019C3659_2653130
MFE: -43.809
Ligand: TPP
Species: Arthrobacter sp. 8AJ TPP
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA051002 URS0000D948CE_1798267 URS0000C071AF_1736462 URS00019C3659_2653130
Length 120. 120. 121. 119.
Similarity - 0.972 0.971 0.971
Ensemble Norm 0.997 - - -
MFE -40.631 -43.388 -57.089 -43.809
Ligands - SAM Mn2+ TPP
Gene HSD17B7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 13. 6.004 4.001
Length SE - 0. 1. 1.
Lev Distance - 33. 35. 36.
UBS 9. 8. 10. 10.
BS 0. 2. 0. 0.
ILL 3. 1. 3. 2.
ILR 1. 2. 3. 2.
H 4. 3. 4. 4.
BL 2. 1. 3. 2.
BR 1. 2. 1. 2.
UN 0.092 0.083 0.025 0.067

Sequences

Field Description
UTR seq + 25 ucugauuggugacgggugaggcggcccgaaaucguaggacuuccgaaagcagcggcggcguuugcuucacugcuuggaagugugagugcgcgaagATGCGAAAGGTGGTTTTGATCACCG
UTR dot + 25 ((((..((((..(((((……)))))..))))))))(((((((..(((((.((.(((….))))).))))))))))))…….(((……)))…((((((….)))))).
RS 1 seq CUCUUAUCCAGAGAGGCUGAGGGACCGGCCCUGCGAAGCCUCGGCAACCUGUCCCAGCGGACCUACGUCCGAUGGAUGUGGUGCCAACUCCGGCAGAACGUCGUUUCUGGAAGAUGAGAG
RS 1 dot (((((((((((((((((((((((…..)))).)..))))))((((.(((((((…(((((….)))))..))))).))))))…..((((…..))))..))))))…))))))
RS 2 seq CCCGCCGUCAUCGGGGAGUAGCCGCCCGCGCCGAUCAGCGGGGUUCGCGUCAACACACUUCCUCUCGCCCGGAGAGGAUGGCGCGUUCUGGCCCGUCAGGGCCCUGGCAAGACCGCUGGCU
RS 2 dot (((((.(((..((.((.((….)))).))..)))..)))))(..(((((((…….(((((((…..))))))))))))))..).(((((….)))))(((((……)))))..
RS 3 seq GGCUGGUACUGCGGGAGCCCGCGGCAGCUGUCAUAAAGCGCCGGGCUGAGAGGGCGUCAGAGCCGACCGCUUGACCUGAUCCGGUUAAUGCCGGCGUAGGGAAGGAACCACAUGCGCAA
RS 3 dot (((((…((((((….)))))))))))((((…((((.(((.((((…….))))..)))..))))))))……((((….))))((((((((……)).).)))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table