Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA051003 Similarity: 0.969 Similarity: 0.968 Similarity: 0.967
UTR: 5HSAA051003
Gene: HSD17B7_0
MFE: -39.584
ENS: 0.997
Length: 124.
Predicted Ligands:
SAM - 12/20
cobalamin - 3/20
TPP - 2/20
 RS: URS0000ABA86B_720555
MFE: -40.190
Ligand: SAM
Species: Bacillus atrophaeus 1942 SAM riboswitch (S box leader)
 RS: URS0000C7EEF5_1134406
MFE: -39.125
Ligand: SAM
Species: Ornatilinea apprima SAM riboswitch (S box leader)
 RS: URS0000D7FC8B_1801951
MFE: -39.419
Ligand: SAM
Species: Planctomycetes bacterium GWC2_39_26 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA051003 URS0000ABA86B_720555 URS0000C7EEF5_1134406 URS0000D7FC8B_1801951
Length 124. 125. 125. 124.
Similarity - 0.969 0.968 0.967
Ensemble Norm 0.997 - - -
MFE -39.584 -40.190 -39.125 -39.419
Ligands - SAM SAM SAM
Gene HSD17B7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 19.001 11.005
Length SE - 1. 1. 0.
Lev Distance - 40. 35. 41.
UBS 8. 8. 8. 8.
BS 0. 0. 2. 0.
ILL 3. 2. 0. 1.
ILR 2. 3. 2. 3.
H 4. 3. 3. 3.
BL 1. 1. 2. 3.
BR 0. 0. 2. 1.
UN 0.121 0.152 0.088 0.194

Sequences

Field Description
UTR seq + 25 guacucugauuggugacgggugaggcggcccgaaaucguaggacuuccgaaagcagcggcgguguuugcuucacugcuuggaagugugagugcgcgaagATGCGAAAGGTGGTTTTGATCACCG
UTR dot + 25 ….((((..((((..(((((……)))))..))))))))(((((((..(((((.((((…..))))…))))))))))))…….(((……)))…((((((….)))))).
RS 1 seq UUCUUAUCGUGAGAGGUGGAGGGACUGGCCCUUUGAAACCUCAGCAACCGGUUUGCUUUGCCAAGAAAGGCGAAGUGCCAAGGUGCUAAAUCCAGCAAGCGAUUUUUGUGCUUGGAAGAUAAGAG
RS 1 dot …………(((((((((((…..))))))…)))))(((.((((((..((((((((……)))))))))))..))))))..(((…((((((…….))))))…)))…..
RS 2 seq CUUCUAUCCAGAGAGGUGGAGGGAACGGCCCUUUGAAACCUCGGCAACCUGGGACGUGUGGUCUUACAGCCAAUGUUACGCUCUAAGGUGCCAAUUCCGGCAGGAUAAAAUCUGGGAGAUAGGAG
RS 2 dot (((((((((((((((((((((((…..))))))…)))))(((.((((.(((((((((((……))))….)))).))).)))))))…(((….)))…..)))))…)))))))
RS 3 seq AUCUUAUCUAGAGUGGCAGAGGGACUGGCCCUAUGAAGCCACAGCAACCGGUCUUGUCCAGCAAAUCAGCUGAGACGGGAUGCAGGUGCUAAUUCCUGUCUCAUAAAUUGGGAAAAGAUAAGGU
RS 3 dot …………(((((..((((…..))))…..)))))(((.(((.((((((((((((……)))).))))))))…))))))…..((.(((((…..)))))..))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table