Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA051102 Similarity: 0.980 Similarity: 0.979 Similarity: 0.979
UTR: 5HSAA051102
Gene: HSPA13
MFE: -39.678
ENS: 0.854
Length: 94.
Predicted Ligands:
TPP - 15/20
glycine - 1/20
Mn2+ - 1/20
 RS: URS0000AB265F_59814
MFE: -26.327
Ligand: TPP
Species: Pantoea dispersa TPP riboswitch (THI element)
 RS: URS0000C26E64_270918
MFE: -35.521
Ligand: TPP
Species: Salegentibacter mishustinae TPP riboswitch (THI element)
 RS: URS0000C605D6_1736316
MFE: -32.647
Ligand: glycine
Species: Pseudorhodoferax sp. Leaf267 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA051102 URS0000AB265F_59814 URS0000C26E64_270918 URS0000C605D6_1736316
Length 94. 94. 95. 95.
Similarity - 0.980 0.979 0.979
Ensemble Norm 0.854 - - -
MFE -39.678 -26.327 -35.521 -32.647
Ligands - TPP TPP glycine
Gene HSPA13 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.009 2.009 12.
Length SE - 0. 1. 1.
Lev Distance - 26. 26. 23.
UBS 5. 6. 6. 7.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 2.
ILR 1. 2. 1. 3.
H 3. 2. 3. 3.
BL 0. 1. 1. 2.
BR 1. 1. 1. 1.
UN 0.085 0.181 0.179 0.105

Sequences

Field Description
UTR seq + 25 ugccgggaggagugggggcggugccucacgucugguacagucaucacaagccuguucggcgggacugugATGGCCAGAGAGATGACGATCTTAG
UTR dot + 25 (((((((….((((((……)))))).)))))))..(((((((((..(((((…)))))..)))))))))….(((((….)))))..
RS 1 seq UCGUUCUCAACGGGGUGCCGGUUAACUGGCUGAGAGAGACCCGUCGAACCUGAUCCGGCUCGUACCGGCGUAGGGAUUUGAGAUGCUCCGCCCU
RS 1 dot ((.((((((…….(((((….))))))))))).))….(((((((((..((((……))))..))))..)))))………….
RS 2 seq CAAAUCUCAAAGGGGUGCCACUUAAUUGUGGCUGAGAUCAUACCCAAAGAACCUGGGCAGGUAAUGCUGCCAAGGGACACGCGCAAAAUGCGCAA
RS 2 dot …((((((…….(((((……)))))))))))……….(..(((.(((((……))))).)))..)..(((((…)))))..
RS 3 seq UGCGCCCGGUCAGGAGAGAGCCCUUCUUGCAAGGGCCGCCGAAGGCGCAGGACCCAGCCGUCCAAACGCUCAGGCAAAAGGACUGACCCAGGUCG
RS 3 dot …((((.((.(((((……))))).))..)))).(((…((((..((((……))))…))))..)))…..((((……)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table