Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA051137 Similarity: 0.963 Similarity: 0.959 Similarity: 0.956
UTR: 5HSAA051137
Gene: HSPA4L
MFE: -27.106
ENS: 0.809
Length: 154.
Predicted Ligands:
cobalamin - 13/20
SAM - 2/20
glucosamine - 2/20
 RS: URS00023133CA_167879
MFE: -24.151
Ligand: cobalamin
Species: Colwellia psychrerythraea 34H Cobalamin riboswitch
 RS: URS0000AB1733_653045
MFE: -59.882
Ligand: cobalamin
Species: Streptomyces violaceusniger Tu 4113 Cobalamin riboswitch
 RS: URS0000DAACF2_249567
MFE: -66.764
Ligand: cobalamin
Species: Streptomyces hygroscopicus subsp. decoyicus Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA051137 URS00023133CA_167879 URS0000AB1733_653045 URS0000DAACF2_249567
Length 154. 154. 154. 154.
Similarity - 0.963 0.959 0.956
Ensemble Norm 0.809 - - -
MFE -27.106 -24.151 -59.882 -66.764
Ligands - cobalamin cobalamin cobalamin
Gene HSPA4L - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.008 7.002 16.006
Length SE - 0. 0. 0.
Lev Distance - 46. 52. 53.
UBS 9. 8. 10. 12.
BS 0. 0. 0. 0.
ILL 2. 3. 4. 2.
ILR 4. 3. 4. 3.
H 2. 3. 3. 3.
BL 4. 2. 3. 5.
BR 1. 1. 1. 3.
UN 0.058 0.149 0.097 0.136

Sequences

Field Description
UTR seq + 25 auguuccguuguuucucuggccugggaaguuuguuggcaaggaauauaaugaaguaauucugaaauaugaaaaacuaguugcugcuuauaggcugcuguuacugguaauuuuaugaggaaaccaacuguATGAAACCTATATTACTTTTTATGG
UTR dot + 25 (((((((.(((((((((……)))))……..)))))))))))…((((((((…….((((……((((((.(.((((((((.((((……))))..)))))))).)…))))))))))……..))))))))……
RS 1 seq UGAUUCAAGAUAGAAUUCGUUCUCAAAGGUUUUAUUGUGUUAUCGAAGAUGGUGUAAAUCCAUCGCUGUACCCGCAACUGUGAAUGAACUGAUGUUUAUUUUUACAAUAAAUAUUAAAUCAAAGUCAGAUAGCUAACGAACAAAACUAUACUUA
RS 1 dot ((((.((.(((((((((……….))))))))).))..))))..(((((…….)))))(((((……..(((….(((..(((((((((((…..)))))))))))..)))….))))))))…………………
RS 2 seq AGAGGAAGCCGGUGAGAAUCCGGCGCGGUCCCGCCACUGUCACCGGGGAGCACUCUCCCAUCGCCUGUAUGGGGUCACGGCUCGACCGUACGGUUGCUUUCGUACGCGGGGCUGGAAGACCGGGAGGGGCGCGGAUCCGGGAGCCAGGAGACUU
RS 2 dot ……..(((((((.(….((((……))))..).)))))))…((.(((((((………….((((.((((((…(((((((……)))))))..))))))…)))))))))))))..(..(((……..)))..)..
RS 3 seq AUGAGGAAGUCCGGUGAGAAUCCGGCGCGGUCCCGCCACUGUCACCGGGGAGCGUUCCUCCGACGAAGGUCACGGUCCGCCUCGUGUACGUCCGAUGACGUACACAGGGACUGGAAGGCCGGAGGACUCGCCGAUCCGGGGAGCCAGGAGACUC
RS 3 dot ..(((((((((((((((.(….((((……))))..).)))))))…)).))))))…….((((.(((((..(((.(((((((((….)))))))))))))))))…))))…((.(((.(((…))).)))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table