Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA051173 Similarity: 0.979 Similarity: 0.978 Similarity: 0.978
UTR: 5HSAA051173
Gene: HSPB11
MFE: -36.829
ENS: 0.851
Length: 103.
Predicted Ligands:
TPP - 13/20
glycine - 2/20
guanidine - 1/20
 RS: URS0000AB4F70_335283
MFE: -37.729
Ligand: guanidine
Species: Nitrosomonas eutropha C91 Guanidine-I riboswitch
 RS: URS0000C57B97_1230341
MFE: -29.016
Ligand: TPP
Species: Salimicrobium jeotgali TPP riboswitch (THI element)
 RS: URS0000D79AAB_1817859
MFE: -27.139
Ligand: TPP
Species: Candidatus Firestonebacteria bacterium RIFOXYA2_FULL_40_8 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA051173 URS0000AB4F70_335283 URS0000C57B97_1230341 URS0000D79AAB_1817859
Length 103. 104. 103. 103.
Similarity - 0.979 0.978 0.978
Ensemble Norm 0.851 - - -
MFE -36.829 -37.729 -29.016 -27.139
Ligands - guanidine TPP TPP
Gene HSPB11 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 11.006 15.001
Length SE - 1. 0. 0.
Lev Distance - 27. 25. 24.
UBS 8. 8. 8. 9.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 2.
ILR 4. 3. 3. 2.
H 2. 2. 2. 2.
BL 4. 4. 1. 4.
BR 2. 1. 2. 5.
UN 0.078 0.087 0.155 0.107

Sequences

Field Description
UTR seq + 25 ccuggaggcggggccaggcccagggcaggcgacccgagggccgaggguuuggaacucgcagagguuaaacacuuuaagATGAGAAAAATTGATCTCTGTCTGA
UTR dot + 25 ….(((.(.(((((.(((((.((((….).)))..)))))…))))).)..)))(((((((((((…(((……)))…..)))))))))))….
RS 1 seq AUUACUUUGGGCUAGGGUUCCGGCUUUCCAAGGGAAGUGACUGGUCCGAGGGCCCGAGGCUUCUCCAUAACGAAGCGCCACGGAGGGAUAAAAGCCCGGGAGAU
RS 1 dot ….((((((((((((.((((………..)))).)..))))))))))).((((.(((((.(((.(..((……..))..))))…)))))))))….
RS 2 seq UUGAACUGCUGGGGGCGCGGAUAUCGCUGAGAUAAGGUUUUGCCUUAGUCCCUUUGAACCUGAUGCGGGUCAUGCCGCCGAAGGGAAGCACUCUGCACAUGGG
RS 2 dot ……….(((((((((((((((…..))))….)))))….))))))…..((((.((((((…(((..((….))..))).)))))))).)).
RS 3 seq ACAUGUAAGUAUGGGUGCUGUCCGCCUUCGGCGGGAUGGCUGAGAGUAUACCAUUUGAACCUGUUUGGGUAAUUCCAACGAAGGGAAAGUAAACGGAAAUCAG
RS 3 dot ….((..(.(((((((((.((.(((.((…..)).))).)).))))).)))).)..))(((((((…..((((……))))…)))))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table