Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA051260 Similarity: 0.966 Similarity: 0.965 Similarity: 0.965
UTR: 5HSAA051260
Gene: HSPE1
MFE: -23.511
ENS: 0.966
Length: 135.
Predicted Ligands:
TPP - 9/20
FMN - 4/20
cobalamin - 3/20
 RS: URS0000D781E9_1519565
MFE: -30.432
Ligand: TPP
Species: Fistulifera solaris TPP riboswitch (THI element)
 RS: URS0000D8CDE0_1736535
MFE: -52.744
Ligand: cobalamin
Species: Streptomyces sp. Root431 Cobalamin riboswitch
 RS: URS0000D8329B_35883
MFE: -46.608
Ligand: TPP
Species: Ipomoea nil (Japanese morning glory) TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA051260 URS0000D781E9_1519565 URS0000D8CDE0_1736535 URS0000D8329B_35883
Length 135. 133. 135. 135.
Similarity - 0.966 0.965 0.965
Ensemble Norm 0.966 - - -
MFE -23.511 -30.432 -52.744 -46.608
Ligands - TPP cobalamin TPP
Gene HSPE1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.001 7.004 8.
Length SE - 4. 0. 0.
Lev Distance - 40. 43. 43.
UBS 11. 12. 13. 10.
BS 0. 0. 0. 0.
ILL 2. 3. 2. 1.
ILR 3. 3. 2. 2.
H 2. 2. 2. 2.
BL 4. 4. 5. 5.
BR 6. 6. 7. 4.
UN 0.141 0.113 0.081 0.141

Sequences

Field Description
UTR seq + 25 cguaaggaaucgggaauuaaacuuggaauauugguuaguacauucaaaugcgcuuccuuaacgaauaagcugagguuugguguuaacuuucaaagccaaaacguguugagATGGCAGGACAAGCGTTTAGAAAGT
UTR dot + 25 ……………(((((((((((..((((.((((((.(((….))).)))…..))).))))..)).)))))))))….((((((.(((((….(.((((…..)))).)….).)))).))))))
RS 1 seq CACUCUUUCCGCGGGAGCUUGAUGUGAAAGGAUGCUGAGAGUAAUCAAAGUCUGUUUUGGAUGUGGCUUUGUGUCGACCGUUUGAACCUGCUCAUGGUAAUGCAUGCGAUAGGGAAGGGAAGAUGUGUCAUGG
RS 1 dot ………(((.((((((..((.(((((((((..(((……)))..)))).))))).))..)))))))))..((((((((…(((.(((((.(((…..))).)).))).)))..))))).)))….
RS 2 seq AGGAUGCAGAUCGGCAUGGGGUCCCAGGGCCCCGGGGAGGAAGCCCGGUGAGAAUCCGGCGCGGUCCCGCCACUGUGAGCCCGUACCGGCGAUGGUCACGGGUGAGUCAGGAACUCCCGCCGUCCACACGACCAC
RS 2 dot ……..(.((((.(((((.((.((((((….((((….((((((…….)))).))..))))))).))).)).))))).)))))..((((((((((.((((…..)))).).))))……))))).
RS 3 seq GAAACGCACCAGGGGUGUCUGUAUCUGCUCCAGCCCUGGCUCCCUCGGCCAGGAUGCUGGCUGAAACAGGCUGAGAAAGUCCCUUCGAACCUGAACAGGAUAAUGCCUGCGUAGGGAGCGUGCAUUUCCUUUUCU
RS 3 dot ……….((((((((((((.((.((..(((((((((((…..)))))))..)))))).)).))))))…….))))))……..(((.((((.(((((.(((…….))).))))))))).))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table