Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA051283 Similarity: 0.986 Similarity: 0.982 Similarity: 0.981
UTR: 5HSAA051283
Gene: HTATIP2
MFE: -43.163
ENS: 0.925
Length: 91.
Predicted Ligands:
TPP - 13/20
glycine - 5/20
fluoride - 1/20
 RS: URS0000ABBB8E_553973
MFE: -21.610
Ligand: glycine
Species: Clostridium hylemonae DSM 15053 Glycine riboswitch
 RS: URS0000815245_985002
MFE: -22.035
Ligand: TPP
Species: Staphylococcus argenteus TPP
 RS: URS0000C15209_1703391
MFE: -36.101
Ligand: TPP
Species: Betaproteobacteria bacterium SG8_41 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA051283 URS0000ABBB8E_553973 URS0000815245_985002 URS0000C15209_1703391
Length 91. 90. 92. 89.
Similarity - 0.986 0.982 0.981
Ensemble Norm 0.925 - - -
MFE -43.163 -21.610 -22.035 -36.101
Ligands - glycine TPP TPP
Gene HTATIP2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.002 4.004 5.001
Length SE - 1. 1. 4.
Lev Distance - 15. 22. 19.
UBS 5. 6. 5. 6.
BS 0. 0. 0. 0.
ILL 0. 2. 1. 1.
ILR 1. 2. 2. 2.
H 4. 4. 3. 3.
BL 1. 0. 0. 1.
BR 0. 0. 0. 1.
UN 0.154 0.111 0.217 0.124

Sequences

Field Description
UTR seq + 25 aggucccgccccugugggcggggcgaggcagcgucgccgcgaggccacccggaagaccaagccggcATGGCCGAAACAGAAGCCCTGTCGA
UTR dot + 25 ..(((((((((….)))))))))..(((……)))….(((((.((((………))))..)))))…((((…..))))…
RS 1 seq AUGAUGGAUUUAAGAGAGUCUAUCUGCGGGAUAGCGCCGAAGGGGAAAGGGAUGACCGAAACUCUCAGGCAAAUGAAUUAGAUUCGGACG
RS 1 dot ..(((((((((….))))))))).((……))(((..((((….((…..))….))))..)))…(((((…)))))….
RS 2 seq UAGGGGUGUUUUAUACUGAGAUGAGGCUUGCCCUCAAACCCUUCGAACCUGAUCUAGUUUGAACUAGCGUAGGAAAGUGUUACUAUACAUAU
RS 2 dot ..((((((((((((……)))))))..)))))………….((((..(((((….)))))..))))…((((……))))..
RS 3 seq GGGUCUCGUCCGGGGUGCCGGGCGGGUGAGAGAAACCCUCGGAACCUGAUGCGGGUCAUGCCGCCGUAGGGAAGCGUCGCGCGACACAC
RS 3 dot (((((((((((((….)))))))))……..))))……((((..((((……))))..))))…(.(((….))).)..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table