Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA051284 Similarity: 0.966 Similarity: 0.965 Similarity: 0.962
UTR: 5HSAA051284
Gene: HTATIP2_0
MFE: -53.429
ENS: 0.950
Length: 124.
Predicted Ligands:
TPP - 11/20
glycine - 5/20
molybdenum - 2/20
 RS: URS0000AB4FBE_395963
MFE: -46.938
Ligand: glycine
Species: Beijerinckia indica subsp. indica ATCC 9039 Glycine riboswitch
 RS: URS0000C8A28D_1232866
MFE: -37.471
Ligand: glycine
Species: Caballeronia udeis Glycine riboswitch
 RS: URS0000C1BDF5_42256
MFE: -50.448
Ligand: glycine
Species: Rubrobacter radiotolerans Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA051284 URS0000AB4FBE_395963 URS0000C8A28D_1232866 URS0000C1BDF5_42256
Length 124. 124. 124. 126.
Similarity - 0.966 0.965 0.962
Ensemble Norm 0.950 - - -
MFE -53.429 -46.938 -37.471 -50.448
Ligands - glycine glycine glycine
Gene HTATIP2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 15.003 19.009 2.006
Length SE - 0. 0. 4.
Lev Distance - 41. 40. 46.
UBS 6. 5. 5. 6.
BS 3. 3. 4. 4.
ILL 0. 2. 0. 0.
ILR 0. 1. 2. 0.
H 4. 2. 2. 3.
BL 4. 2. 4. 4.
BR 4. 3. 1. 4.
UN 0.113 0.169 0.210 0.190

Sequences

Field Description
UTR seq + 25 ggcggggcgaggcagcgucgccgcgaggccacccggaagaccaagccggguaggcgcugucuccgucgccuccaacccccccgguccgaccagggaagcATGGCCGAAACAGAAGCCCTGTCGA
UTR dot + 25 (((((.(.((((((((((((((….))).((((((………)))))).)))))))))))).)))))……..(((.(((…))).)))..(((.(((……….))).)))…
RS 1 seq AAAUCCCUAGCGGGAGAGUCCGUUUUCCAAGACAGGUUGGAAGCUUCCGACCGGUUUCGCUGAAAACGGCGCCGAAGGCGCAACCGCCCCGGAAACGCUCAGGCCCACGGACCGCUAGGGGAUG
RS 1 dot …(((((((((((((.((((((((((..((((.(((((((….))))))).))))….))))))))..(((..((((….)))).)))..)).)))………..))))))))))…
RS 2 seq CCGCACGCGUCGGGAGAGAGCGCUGGCCGUUGGUUGUUCGCAUCUGGAACGACAUAAAAACGAAGCCGCGCCGCCGAAGGGGCACACCCACAAACUCUCAGGCAAAAGGACCGGCCGCGUCGAA
RS 2 dot .((.((((((((((((((.((((.(((((((.(((((((…….)))))))…..))))..)))))))…….(((…..)))…..)))))………..))))).))))))..
RS 3 seq GUGAUGGGCGCGGGAGAGAGUCGCGGGAGGAGAAACGGGCCUCCGCCGGCGACCGCCGAAGGUGAAAGGUUCGGGACGAGACGAGUCCCGGCCGAAUCUCUCAGGCAGAAGGACCGCGACCGGAGG
RS 3 dot ….(.((((((((((((((((((.((.((((……..)))).)).)))))((((…))))…((.(((((((…….)))))))))…))))))………..))))).)).)…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table