Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA051285 Similarity: 0.974 Similarity: 0.972 Similarity: 0.972
UTR: 5HSAA051285
Gene: HTATIP2_1
MFE: -49.512
ENS: 0.922
Length: 121.
Predicted Ligands:
TPP - 8/20
guanidine - 6/20
glycine - 4/20
 RS: URS0000C2E6FA_4781
MFE: -38.857
Ligand: TPP
Species: Plasmopara halstedii TPP riboswitch (THI element)
 RS: URS0000AB3B53_1094619
MFE: -47.434
Ligand: TPP
Species: Phytophthora sojae strain P6497 TPP riboswitch (THI element)
 RS: URS0000C08325_1686064
MFE: -47.883
Ligand: zmp-ztp
Species: Methylibium sp. NZG ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA051285 URS0000C2E6FA_4781 URS0000AB3B53_1094619 URS0000C08325_1686064
Length 121. 122. 122. 120.
Similarity - 0.974 0.972 0.972
Ensemble Norm 0.922 - - -
MFE -49.512 -38.857 -47.434 -47.883
Ligands - TPP TPP zmp-ztp
Gene HTATIP2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.002 3. 10.003
Length SE - 1. 1. 1.
Lev Distance - 31. 35. 32.
UBS 10. 9. 10. 9.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 1.
ILR 3. 3. 2. 3.
H 3. 3. 3. 3.
BL 3. 1. 2. 5.
BR 4. 3. 4. 2.
UN 0.041 0.090 0.049 0.092

Sequences

Field Description
UTR seq + 25 ggggcgaggcagcgucgccgcgaggccacccggaagaccaagccggguaggcgcugucuccgucgccuccaacccccccgguccgaccagggaagcATGGCCGAAACAGAAGCCCTGTCGA
UTR dot + 25 ((((.(((((.(((…..(((..(((((((((………)))))).)))..)))…))).)))))…))))((((((…))).)))..(((.(((……….))).)))…
RS 1 seq UCAAUCAGCGAGGGGUGUCGAUUGCCAACCAUGGACCAGUUCCAUGCGUUGACCGGCUGAGAUAAAACCCUUUGAACCUGAUCCGGUUCAUACCGGCGGAGGAACUGCUGCUUUCAUUUGUU
RS 1 dot …((((((((((((((((..(.((((((((((((…..)))))).)))….))).).)))…))))))))…)))))(((((….))))).(((((……..)))))…….
RS 2 seq UCAAUCAGCGAGGGGUGCCGACUGCCAGCCAUGGACCAGUUCCAUGCGUUGGCCGGCUGAGAUCAAACCCUUAGAACCUGAUCCGGUUCGCACCGGCGGAGGGACUGCUGUCACUUGUGGUG
RS 2 dot …((((((.((((((((((…((((((((((((…..)))))).))))))))))………)))))).)…)))))(((((….)))))((.((((((….))).))).))…
RS 3 seq ACCGCGCUGCACAACUGGCGAUGAGGCCUUCCAAAGGCCGGAGGUGGUCAACCACCGGGAAGUGUGGUCGGGGCGCGCACAUGGCGCGCCACGGUUCAGCCGUUCGCCUGGGCAGCUUCG
RS 3 dot .(((.(((((((..((((.(.(((.((((((……..))))))..)))..).))))…))))))))))(((((((…..)))))))…((((((.(….).))))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table