Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA051339 Similarity: 0.977 Similarity: 0.976 Similarity: 0.974
UTR: 5HSAA051339
Gene: HTR5A
MFE: -16.032
ENS: 0.739
Length: 89.
Predicted Ligands:
TPP - 12/20
glycine - 4/20
zmp-ztp - 2/20
 RS: URS0000ABA29B_137591
MFE: -25.007
Ligand: TPP
Species: Weissella cibaria TPP riboswitch (THI element)
 RS: URS0000837CF3_585
MFE: -22.714
Ligand: TPP
Species: Proteus vulgaris TPP
 RS: URS0000C315C1_1550400
MFE: -19.954
Ligand: glycine
Species: marine actinobacterium MedAcidi-G2A Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA051339 URS0000ABA29B_137591 URS0000837CF3_585 URS0000C315C1_1550400
Length 89. 89. 89. 89.
Similarity - 0.977 0.976 0.974
Ensemble Norm 0.739 - - -
MFE -16.032 -25.007 -22.714 -19.954
Ligands - TPP TPP glycine
Gene HTR5A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 13.010 15.008 10.008
Length SE - 0. 0. 0.
Lev Distance - 27. 28. 32.
UBS 2. 4. 4. 4.
BS 4. 2. 2. 2.
ILL 0. 0. 1. 0.
ILR 0. 1. 2. 0.
H 2. 2. 2. 3.
BL 0. 2. 1. 0.
BR 2. 2. 1. 1.
UN 0.258 0.157 0.169 0.348

Sequences

Field Description
UTR seq + 25 gccgccuuaaguccuccugaacaccccuucugcaaguaccccagggcggucuccugacccagagATGGATTTACCTGTGAACCTAACCT
UTR dot + 25 ..(((..((((((((((((…..((((…………..)))).((((….))))))).)).)))))))…)))……….
RS 1 seq UCAAACAAGCUGGGGUGCCAAGUGGCUGAGAUGAUACCCAUAGAACCUGAGCAGGAUAAUGCCUGCUAGGGAGCUUGGUUUGUUUACGA
RS 1 dot .((((((((((.(((((((….)))………))))……(((.((((((……)))))).))))))))).))))…….
RS 2 seq GGCUUUGGCUCGGGGUGCCUUAUGGCUGAGAUGAACCCGUAUAACCUGAUCUGGAUAAUGCCAGCGUAGGGAAGUCAAGGUAACUCUGC
RS 2 dot .((((((((((.(((((((….)))……..))))……((((..((((……))))..)))))).))))))))……..
RS 3 seq ACAUUGACUGCGGGAGAGUCCAACUAAGUUGGCGCCGAAGGAGCAAGGGUCCCCCCGAAACUCUCAGGCAAAAGUACCGCAGGAUAUAG
RS 3 dot …….(((((((((((((((((…))))).(((….).))..(((….)))…))))))………..))))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table