Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA051412 Similarity: 0.973 Similarity: 0.971 Similarity: 0.971
UTR: 5HSAA051412
Gene: HYLS1
MFE: -48.726
ENS: 0.867
Length: 125.
Predicted Ligands:
TPP - 7/20
molybdenum - 4/20
cobalamin - 3/20
 RS: URS0000C0D256_948458
MFE: -52.458
Ligand: TPP
Species: Cellulomonas sp. Mn5-4 TPP riboswitch (THI element)
 RS: URS0000DB664A_37921
MFE: -47.323
Ligand: TPP
Species: Arthrobacter agilis TPP riboswitch (THI element)
 RS: URS0000C519FF_1681197
MFE: -48.173
Ligand: TPP
Species: Arthrobacter sp. RIT-PI-e TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA051412 URS0000C0D256_948458 URS0000DB664A_37921 URS0000C519FF_1681197
Length 125. 124. 124. 125.
Similarity - 0.973 0.971 0.971
Ensemble Norm 0.867 - - -
MFE -48.726 -52.458 -47.323 -48.173
Ligands - TPP TPP TPP
Gene HYLS1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.008 1.015 5.014
Length SE - 1. 1. 0.
Lev Distance - 33. 37. 37.
UBS 7. 8. 7. 8.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 1.
ILR 2. 3. 2. 2.
H 3. 4. 3. 3.
BL 2. 1. 2. 2.
BR 1. 1. 2. 3.
UN 0.160 0.073 0.282 0.280

Sequences

Field Description
UTR seq + 25 aaagcuaacagaaucugcggugcucugcuggcgacuggcaggacgcggugcagagagcggacuuccgcgacgcggaagguccuacaguguaggggaagcaATGGAAGAACTTCTACCTGATGGAC
UTR dot + 25 ………….((((((.(((((((((((…))))))))..))).))))))…….(((((((…)))))))((((..(((.(((((((…………..))))))))))..))))
RS 1 seq CCCGAACGACAGGGGAGCGUCGUCCGGGCCCCCACCGGACGCAGGACGCUGAGAGUGCGGAACUCCGCAGACCCUCGAACCUGAUCCGGUUCACACCGGCGUAGGGAGUCGGGAUUCUCAGGGC
RS 1 dot (((……..))).((((((((((((…….))))))….))))))…..(((((….)))))..((((.((((((((((((((….)))))……..)))))).)))..)))).
RS 2 seq AACAAACGACAGGGGAGCGCCGACCCGCAGCACGCUGCGGAUCGGGCGCUGAGAGUGCGGACAGCCGCAGACCCUCGAACCUGAUCCGGCUAGUACCGGCGAAGGGAGUCGAGUUCUCAGAGUG
RS 2 dot ……………((((((((.((((((….)))))).)))).))))…..(((((….)))))….(((((.(((…((((……))))…)))…)))))………..
RS 3 seq AACGAACGACAGGGGAGCGCCGAGCCGCGGUACACCGCGGACACGGGCGCUGAGAGUGCGGACCGCCGCAGACCCUCGAACCUGAUCCGGUUAGUACCGGCGAAGGGAGUCGAGUUCUCAGAGUG
RS 3 dot ……………(((((((.(((((((….)))))).).))).))))…..(((((….)))))….(((((.(((…(((((….)))))…)))…)))))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table