Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA051436 Similarity: 0.960 Similarity: 0.959 Similarity: 0.957
UTR: 5HSAA051436
Gene: HYOU1
MFE: -51.028
ENS: 0.828
Length: 146.
Predicted Ligands:
FMN - 17/20
cobalamin - 3/20

 RS: URS0000C29601_1460636
MFE: -37.956
Ligand: FMN
Species: Geomicrobium sp. JCM 19039 FMN riboswitch (RFN element)
 RS: URS00009E76A3_40324
MFE: -61.450
Ligand: FMN
Species: Stenotrophomonas maltophilia FMN
 RS: URS0000BF4974_1192034
MFE: -62.602
Ligand: cobalamin
Species: Chondromyces apiculatus DSM 436 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA051436 URS0000C29601_1460636 URS00009E76A3_40324 URS0000BF4974_1192034
Length 146. 146. 146. 146.
Similarity - 0.960 0.959 0.957
Ensemble Norm 0.828 - - -
MFE -51.028 -37.956 -61.450 -62.602
Ligands - FMN FMN cobalamin
Gene HYOU1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.005 10.001 1.003
Length SE - 0. 0. 0.
Lev Distance - 48. 50. 57.
UBS 13. 11. 11. 13.
BS 0. 0. 1. 0.
ILL 3. 1. 3. 2.
ILR 2. 1. 2. 2.
H 5. 5. 4. 5.
BL 5. 5. 3. 5.
BR 4. 3. 4. 4.
UN 0.089 0.158 0.123 0.144

Sequences

Field Description
UTR seq + 25 gagcgcgcgccgcguccggggccggcuggugcgcgagacgccgccgagaggcagggccgggcggccgaggcuccaauggaaucucggaggaaaacaccggugaucgugacccugaaagaaaATGGCAGACAAAGTTAGGAGGCAGA
UTR dot + 25 …(((((((((.(.(((….)))))))))))))…..(((((….(((…))).)))))((((((.(((…))).)))))).((……)).((..((.((((.(((..(…..)..)))…..)))).)).))…
RS 1 seq AUAAAUCUUCGGGGCAGGGUGAAAUUCCCGACCGACGGUAAGUUACGCGCGUUGUAACAAGUCCGUGACCCACUUUAUAUUUAAUAAGUGGUUGAUCCGGUGUGAUUCCGGAACCGACAGUAUAGUCUGGAUGGGAGAAGAUUGCA
RS 1 dot ….(((.((((..(.(((…….)))).)))).)))..((((((.((.(((…))))).))))))((((((……….))))))….(((((…….))))).(((.(((……)))..)))…………
RS 2 seq AAACGUCUUCAGGGCGGGGUGCAACUCCCCACCGGCGGUAGGUGCGCAAGCACGAGCCCGCGAGCGCUCCGGCCCACGGCCGGGGGUCAGCAGAUCCGGUCCAAUGCCGGAGCCGACGGUCAUAGUCCGGAUGAAAGAAGACGGUG
RS 2 dot …(((((((..((.((((…….)))).))…(((..((((….))))..))).((..((.((((((((…))))))))))..))..((((((.(..((((((…….))).))).).))))))….)))))))…
RS 3 seq AACAGGGAAGCCGGUGACAAUCCGGCGCGGCCCCCGCCACUGUGACCGGGGACGAAGGCGGAGCAUCCACUGGAUCUCCGGCGCCUCCAUCGAAGCGCCGGGUCUGGGAAGGUCCGCCGGAGGACGAUCCGGGAGCCAGGAAACCU
RS 3 dot ………(((((…….)))))…(((..((((.(((….))))).))..)))((((.((((…))))))))(((((.((….)).)))))((.(((.(((..((((……))))..))).))).))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table