Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA051469 Similarity: 0.977 Similarity: 0.976 Similarity: 0.976
UTR: 5HSAA051469
Gene: IARS2
MFE: -22.736
ENS: 0.877
Length: 97.
Predicted Ligands:
TPP - 19/20
cobalamin - 1/20

 RS: URS000233428B_1817841
MFE: -23.972
Ligand: cobalamin
Species: Candidatus Doudnabacteria bacterium RIFCSPLOWO2_01_FULL_44_21 AdoCbl variant RNA
 RS: URS0000ABD480_1263041
MFE: -24.964
Ligand: TPP
Species: Bacteroides coprophilus CAG:333 TPP riboswitch (THI element)
 RS: URS0000C462A7_318464
MFE: -19.283
Ligand: TPP
Species: Clostridium sulfidigenes TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA051469 URS000233428B_1817841 URS0000ABD480_1263041 URS0000C462A7_318464
Length 97. 97. 96. 96.
Similarity - 0.977 0.976 0.976
Ensemble Norm 0.877 - - -
MFE -22.736 -23.972 -24.964 -19.283
Ligands - cobalamin TPP TPP
Gene IARS2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.004 11.007 6.005
Length SE - 0. 1. 1.
Lev Distance - 28. 27. 29.
UBS 6. 7. 7. 6.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 1.
ILR 0. 1. 2. 0.
H 3. 3. 3. 3.
BL 3. 1. 1. 1.
BR 3. 3. 2. 2.
UN 0.206 0.268 0.125 0.135

Sequences

Field Description
UTR seq + 25 acuugauuuaugaauuaauugcaggaauuguuaaaaaaggugaaauuuauuccuggaucagcacugaauggcATGCGTTGGGGGCTGCGCCCTCGCG
UTR dot + 25 ……………….(.(((((((………………..))))))).).((((.((.((((…..)))).)).))))(((….)))
RS 1 seq UUUCUAAAAGUUCUAUUUAGGGAAGUCCGGUAAGAUUCCGGCACUGUGCCGCAACUGUAAUCCCAGGCAACUGGGUAGUCAGAUCGCUAAUUAGAGC
RS 1 dot ……………….((.((((((((…….)))).))).).))….(((….(((((….)))))….)))…(((……)))
RS 2 seq AGUAAAACAAAGGGGUGCCCUACCUGACGGGCUGAGAUCAUACCCUACGAACCUGAUGCGGUUAGCACCGACGAAGGGAUUGUUGCUUAUCGGCAU
RS 2 dot ………..(((((((((……..))))………)))))((((.(((..((((((….)))).))..))).))))((((….)))).
RS 3 seq AUAUUGUGCUAGGGGUGCUACGGCUGAGAAAUGAUUUUUCAUUACCCUUUACCUGACCUAGAUAAUGCUAGCGUAGGGAAGCGAUUAAUAAGCUUA
RS 3 dot ……….(((((((………….((((….)))))))))))..(((.((((((……)))).)).)))((((………)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table