Detected as a riboswitch by 9 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA051493 Similarity: 0.953 Similarity: 0.951 Similarity: 0.950
UTR: 5HSAA051493
Gene: ICA1
MFE: -51.923
ENS: 0.871
Length: 169.
Predicted Ligands:
Mn2+ - 11/20
cobalamin - 3/20
Mg2+ - 3/20
 RS: URS0000ABB3C8_335283
MFE: -64.173
Ligand: Mn2+
Species: Nitrosomonas eutropha C91 yybP-ykoY manganese riboswitch
 RS: URS0000AB880F_393595
MFE: -72.627
Ligand: Mn2+
Species: Alcanivorax borkumensis SK2 yybP-ykoY manganese riboswitch
 RS: URS00023291D0_1797946
MFE: -59.615
Ligand: cobalamin
Species: Elusimicrobia bacterium RIFCSPLOWO2_01_FULL_59_12 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA051493 URS0000ABB3C8_335283 URS0000AB880F_393595 URS00023291D0_1797946
Length 169. 168. 169. 171.
Similarity - 0.953 0.951 0.950
Ensemble Norm 0.871 - - -
MFE -51.923 -64.173 -72.627 -59.615
Ligands - Mn2+ Mn2+ cobalamin
Gene ICA1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.002 8. 11.011
Length SE - 1. 0. 4.
Lev Distance - 59. 63. 56.
UBS 10. 9. 11. 8.
BS 0. 0. 0. 2.
ILL 2. 2. 1. 1.
ILR 4. 3. 2. 3.
H 3. 4. 4. 3.
BL 3. 1. 4. 3.
BR 2. 1. 2. 1.
UN 0.053 0.101 0.047 0.158

Sequences

Field Description
UTR seq + 25 cgcgccgggcgggcugcaggaagcagcaggagacgcccggcagccgggacggucggggacgccugguuauaauauaacuuauccucucaugcuuuuuuccugccccuucuccccaaaucaucaacaauagaagaagaagaaaacATGTCAGGACACAAATGCAGTTATC
UTR dot + 25 …((((((((.(((((…..)))))……))))))))(((((((.((……..)))))))))…..((((((((((((..((((.(((((((……(((((………………)))))..))))))).))))..))))……)).)))))).
RS 1 seq UUUCAGGUCAUUGGGGAGUAGCCACUCUUUAUCACAAAGAGGCUUACAUCAACAUACUUGACCCACAGGUCAUGGUGUAGGCAGCCCUUCGCCUGGCAAGACCUUUGACUGCGAUGCUUCCACUAGGCCGGAGAUGUAUCGUGGUCAAUCGUCUUUUCCGGCCAGGAA
RS 1 dot …..(((.(((….))).))).((((((…..))))))((((((((((…….(((((….)))))))))))))))………(((((((((((..(((((((((((((((((……..))))..)))))))))))))..)))))…..))))))..
RS 2 seq UGCACCCUCUUUGGGGAGUAGCCUGCUUCCGAAACUCGGAAGAGUUCGUGUCAACAUAAUUGGCCAGAUGCCAUGGUGCGAACACCUCUCGGUUGGCGAGACCAUCGAUAUAUCCAUGCCUAAGGUCGGGCGUGUGGAUAUAUCGUGGACUCGAUAUGCCCGACCGGAG
RS 2 dot (((.((((….)))).)))…..(((((((…))))))).((((((((((…….((((…..))))))))))))))..(((.(((((((((((.(((.((((((((((((((((……))))..))))))))))))))).))))……))))))))))
RS 3 seq GGCUCUUUGAAUCGAGGCCGUAAGAGGAACCUGGUGUGAUUCCAGGACUGCCCCGCAACGGUAAGUGACAGCAGAUGAUUUGAUGACUGGAUGGUUAGAUGACCGGUCAUCGAGUAGUCCGGUCAUCUGGCGUCUUAAGUCCGGUCGACUUGCGGCCUCCAAAAUUCUGAA
RS 3 dot ……..((((.(((((((((((…..(((((…….))))).((((..(((……..)))…))))…..(((((((((((((.(((((((((((((.(……..).)))))))))))))))))..))))..))))))))))))))))….))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table