Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA051561 Similarity: 0.964 Similarity: 0.963 Similarity: 0.962
UTR: 5HSAA051561
Gene: ICOS
MFE: -34.441
ENS: 0.809
Length: 137.
Predicted Ligands:
cobalamin - 6/20
FMN - 5/20
molybdenum - 4/20
 RS: URS0002320C2F_1229780
MFE: -48.834
Ligand: cobalamin
Species: Candidatus Microthrix parvicella RN1 Cobalamin riboswitch
 RS: URS0000D94D45_733
MFE: -26.354
Ligand: molybdenum
Species: Haemophilus haemoglobinophilus Moco (molybdenum cofactor) riboswitch
 RS: URS000232EF71_300852
MFE: -64.512
Ligand: cobalamin
Species: Thermus thermophilus HB8 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA051561 URS0002320C2F_1229780 URS0000D94D45_733 URS000232EF71_300852
Length 137. 137. 135. 139.
Similarity - 0.964 0.963 0.962
Ensemble Norm 0.809 - - -
MFE -34.441 -48.834 -26.354 -64.512
Ligands - cobalamin molybdenum cobalamin
Gene ICOS - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 23. 3. 21.004
Length SE - 0. 4. 4.
Lev Distance - 40. 44. 37.
UBS 8. 11. 8. 10.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 5.
ILR 2. 4. 2. 2.
H 2. 2. 3. 2.
BL 1. 4. 1. 3.
BR 4. 4. 3. 2.
UN 0.153 0.168 0.163 0.094

Sequences

Field Description
UTR seq + 25 gggagaacgguaugaagguagggaagaacguuccauaccauggaaggaacaagugcaaagagccuguggcaggaaggaaugaggagaaaucaaugguucugccaauuaugagATGAAGTCAGGCCTCTGGTATTTCT
UTR dot + 25 ……..((((((((.((……..)).))).)))))………..((((((..((((((((((((((((…..(((…….)))….))))))))……………))))).))).))))))..
RS 1 seq GUUAAACCGCCAGCUGUGCUUGUCUGGCUGAGAUCACACGAGGACAGGGGAAGCCGGUCAAAAUCCGGCGCUGACCCGCAGCCGUAGGUGGGGUUCGCCCCACGAGUCGGAAUGCCUGACCCCGUGCGCUCCCCUGU
RS 1 dot ……..((((((…….).)))))……………((((((((.((((((((…((((((((.(((((.((.(….).))))))).))…….))))))…..)))))..).))..))))))))
RS 2 seq AUUAUCGCAUAACUCCGAGCUUGCUUUCCUAAGUUGAAAAAUAUGGAAGCAAUGCCAGCAAAUAUCAUUGCUCAGGGAUAAGAUAGGAAACAACUUAUCCUUUCUUAUUUAAAAAGGUGUCUGGUGCAACAAUCU
RS 2 dot ….(((……..)))((((((((((….(((….)))..)))))))).))…………((((((((((((((((.((((………)))).)))))))……….))))).))))……
RS 3 seq CCGGGGUGCCCCAGGGCCCGGAUGUCCUGGGGCGCAAAAGGGGGAAGACCGGUGAAAGUCCGGCGCUGUGCCGCAACGGUAACCGGCCCUAAGCCACAGGCCUAGCGUCUUGGCCGGAAGCCCGGAUACCCGCCCCGGU
RS 3 dot …..((((((((((((……))))))))))))…..((((…..(((.(…((((((.(((..((((..(((.((…((((……….)))))).)))..))))….))))))))).))))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table