Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA051562 Similarity: 0.980 Similarity: 0.979 Similarity: 0.977
UTR: 5HSAA051562
Gene: ICOS_0
MFE: -31.635
ENS: 0.921
Length: 109.
Predicted Ligands:
TPP - 9/20
SAM - 6/20
zmp-ztp - 2/20
 RS: URS0000D9732E_1797224
MFE: -35.746
Ligand: TPP
Species: Alphaproteobacteria bacterium RIFCSPHIGHO2_12_FULL_63_12 TPP riboswitch (THI element)
 RS: URS00023123A8_591159
MFE: -49.290
Ligand: zmp-ztp
Species: Streptomyces viridochromogenes DSM 40736 ZMP/ZTP riboswitch
 RS: URS0000DB2C92_487165
MFE: -50.581
Ligand: zmp-ztp
Species: Streptomyces swartbergensis ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA051562 URS0000D9732E_1797224 URS00023123A8_591159 URS0000DB2C92_487165
Length 109. 109. 110. 109.
Similarity - 0.980 0.979 0.977
Ensemble Norm 0.921 - - -
MFE -31.635 -35.746 -49.290 -50.581
Ligands - TPP zmp-ztp zmp-ztp
Gene ICOS - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 6. 6.
Length SE - 0. 1. 0.
Lev Distance - 25. 25. 28.
UBS 9. 9. 9. 9.
BS 0. 0. 0. 0.
ILL 4. 2. 3. 3.
ILR 3. 3. 3. 2.
H 1. 1. 1. 1.
BL 3. 4. 5. 5.
BR 3. 2. 2. 3.
UN 0.064 0.083 0.082 0.073

Sequences

Field Description
UTR seq + 25 agcaaauagaaaacaaccgagagccugaauucacugucagcuuugaacacugaacgcgaggacuguuaacuguuucuggcaaacATGAAGTCAGGCCTCTGGTATTTCT
UTR dot + 25 …….(((((…((((((.((((((.((((.(((..(((..(((((…((((…….))))…)))))..)))..))))))).))))))))).))).)))))
RS 1 seq GAGCCAUCCGAGGGGCGCGGGCCUCACCCGCUGAGACUGUGUUGAUCACACGGGCACCCUUUGAACCUGAUCGGUUAACACCGGCGUAGGGACGGAACCUUGCUCUCGA
RS 1 dot ……..((((.((((.((.((((.(((((((…..(((((((((…((((………..))))…))))))))))))))..)))).))..)).)))))))).
RS 2 seq CCCCCGGGCCGUGACUGGCGUGCUGGGAUGGGACCGACCAUCGGGAAGCGGCCCCCGGACCCGGUUGAACCCCGGGGACCGGAACCGUGCCGUGCGCCUGGGCCGUACCG
RS 2 dot ….(((.(((…..(((((((.((.((((..(((.((.(((((…(((((………)))))…)))))))..)))..)))).)))))))))))).)))…..
RS 3 seq ACCGAGGGCCGUGACUGGCGCGCUGGGAUGGACAAACCAUCGGGGAGCGGCCCCCGGACCCGGCUGAACCCCGGGGACCGGAACCGUGCCGUGCGCCUGGGCCGUACCG
RS 3 dot ….(.((((….(.(((((((.((.((((…..((.((((((..(((((………)))))..))))))))…….)))).))))))))).))))).)….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table