Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA051579 Similarity: 0.983 Similarity: 0.983 Similarity: 0.980
UTR: 5HSAA051579
Gene: IDE
MFE: -41.348
ENS: 0.981
Length: 101.
Predicted Ligands:
purine - 6/20
TPP - 6/20
zmp-ztp - 5/20
 RS: URS0000C613E3_1406431
MFE: -37.846
Ligand: zmp-ztp
Species: Massilia sp. WF1 ZMP/ZTP riboswitch
 RS: URS0000D8CE42_1945859
MFE: -39.934
Ligand: fluoride
Species: Rhodanobacter sp. B05 Fluoride riboswitch
 RS: URS0000C286DB_1263063
MFE: -23.729
Ligand: zmp-ztp
Species: Clostridium bartlettii CAG:1329 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA051579 URS0000C613E3_1406431 URS0000D8CE42_1945859 URS0000C286DB_1263063
Length 101. 100. 101. 101.
Similarity - 0.983 0.983 0.980
Ensemble Norm 0.981 - - -
MFE -41.348 -37.846 -39.934 -23.729
Ligands - zmp-ztp fluoride zmp-ztp
Gene IDE - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 9.002 7.012
Length SE - 1. 0. 0.
Lev Distance - 21. 20. 24.
UBS 7. 7. 9. 5.
BS 0. 0. 0. 0.
ILL 3. 2. 4. 2.
ILR 3. 4. 3. 2.
H 2. 2. 2. 2.
BL 2. 1. 2. 1.
BR 1. 1. 3. 1.
UN 0.089 0. 0.040 0.198

Sequences

Field Description
UTR seq + 25 gcaugcgcagugcgcagggccggcucgaagcgcaagcaggaagcguuugcggugaucccggcgacugcgcuggcuaATGAGCAAACTTTGGTTCAAACAAG
UTR dot + 25 ((..(((((((.(((.(((…(((..((((((………))))))..)))…))).))))))))))..))…(((((……..)))))……
RS 1 seq UACGUCUCACGUAACUGGCGAAAACCGCCUGCCGGCGGUGAAGGUGGAGAUCCACCGUGGAGCGUGAGAUGUCGUUUUGCCGUUCGCCUGGGCAGCCUCC
RS 1 dot .(((((((((((..((((.((…(((((((((…)))..))))))…))..))).)..)))))))))))….(((((………)))))…..
RS 2 seq GGCCGCGUGGGAGAUGGCAUGCCUCCCGUUCCGGCGCGACUGUCGCGGGACAAACCACCUCCCGUGCGACCCACGUCGAGGUUGAUGAUGCCUGCAUCGCC
RS 2 dot ((.((((((((((.(((..((..((((((..(((…..)))..))))))))..))).)))))))))).))..((..(((((…….)))).)..))..
RS 3 seq AAAUGGUCAAGUGACUGGUGGAAACAUCGAAAGAUGCGUAGGAUAACCUACAGGGAGCUUGAUUAUAUAUUUAGAAAUUGCCGACCGCCUGGGCACGUAUG
RS 3 dot ..((((((((((..((.((((….(((………….)))…)))).))..))))))))))…………((((………))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table