Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA051619 Similarity: 0.946 Similarity: 0.939 Similarity: 0.937
UTR: 5HSAA051619
Gene: IDH3G
MFE: -85.853
ENS: 0.855
Length: 211.
Predicted Ligands:
cobalamin - 19/20
FMN - 1/20

 RS: URS00023321A9_1895708
MFE: -72.429
Ligand: cobalamin
Species: Alphaproteobacteria bacterium 62-8 Cobalamin riboswitch
 RS: URS000231B4F5_1895781
MFE: -79.143
Ligand: cobalamin
Species: Mesorhizobium sp. 65-26 Cobalamin riboswitch
 RS: URS000232EDAD_414684
MFE: -80.506
Ligand: cobalamin
Species: Rhodospirillum centenum SW Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA051619 URS00023321A9_1895708 URS000231B4F5_1895781 URS000232EDAD_414684
Length 211. 211. 209. 210.
Similarity - 0.946 0.939 0.937
Ensemble Norm 0.855 - - -
MFE -85.853 -72.429 -79.143 -80.506
Ligands - cobalamin cobalamin cobalamin
Gene IDH3G - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 9. 9.
Length SE - 0. 4. 1.
Lev Distance - 70. 70. 77.
UBS 17. 17. 19. 17.
BS 0. 0. 0. 0.
ILL 3. 4. 5. 3.
ILR 2. 3. 3. 2.
H 5. 4. 5. 7.
BL 7. 6. 7. 5.
BR 7. 7. 7. 6.
UN 0.095 0.081 0.115 0.086

Sequences

Field Description
UTR seq + 25 ggucgcggucccccccucaacauggcggcagcggugcucuaggcgccggaagggggcgugaaucggugcgaccgcgcgcgugcgcaguaccggguccgcgccuguccccgaaacuucgcaccccgucgaacucucgcgagagcgguaucugcgugucgggacgugcggaggcucucacuuuccgucATGGCGCTGAAGGTAGCGACCGTCG
UTR dot + 25 .(((((.((…………)).)))))…((((((…))))))(((.(((.(((.((.(((((((….((((….)))).))))))).))))).))).)))..((..((((((((((((.((……(((.(((……)))))))).))))..))))))))..))…………(((((((((….))))).))))..
RS 1 seq UGCGCUUGAAAGGGGCGCGGUGGGGCACUAGAAAAACAGGGAUCGCGACGGUCAAAGGGAACAUGGGGUGCGGCGAACGCCAAAUCCCCGGCUGCCCCCGCAACUGUAAGCGGCGAGUGAGCCCCGCAUCAUGCCACUGGGAAACUGGGAAGGCGCGAGGUCCACGUCAGAGCCGCAAAGCCAGGAGACCUGCCGUUCGCGCGUCGUCCUU
RS 1 dot .((((((…..)))))).((((((…………………(.(((((…((((…(((.((…….)).)))..)))).))))))))))))……..((((((((((.(((.(((…..(((.((((….))))…)))))).))).))).))…)))))……(((((((.(((…..))).))).)))).
RS 2 seq AGCGUGCCCUCCGGAACUGGUUCCGCCGCGAGGCGGAUGAAAAGGGAACAUGGUGCGGCCGGCACAUCGGGCCAAAGCCAUGACUGCCCCCGCAACUGUAACCGUUGAGCCAUCUUCCAUGAUGCCACUGACCGCCGAUAGGGGUCGGGAAGGCGGAGGACCGGCGAGGAGACGGAAGUCAGGAGACCUGCCUGUUCCAGUCACCCAUG
RS 2 dot …((.((….)).))….((((((….))))))……((..(((.(.(((((..((((..((((((….))).))).)))).))))).))))..))…..(((.((((((…..(((.((((((.((….))))))))…)))))))))..)))..((.(((((((..((((…….)))))))).))).))….
RS 3 seq UACGGUAUUUAGCGUUACGGUCCUCCGGACAACACAAUAUGUAGUUAUCCGGGGGCUAAGAGGGAAGCCGGUGCAAUUCCGGCGCUGCCCCCGCAACUGUCAGCGGCGAGCUGCCGACCUUUCAUGUCACUGGUGCCGACCGGCACCGGGAAGACCGGACGGUGGCGCGGACCCGCAAGCCAGGAGACCUGCCGUAACCCAGUCUACCAU
RS 3 dot .((.(((……..))).))((((((((.((((((…))).))).))))))))……(((..(((((…….)))))….)))((((……..))))…(((((((.((..((…((.((((((((….)))))))))).))..)).)))))))(((….)))……(((((.(((……..)))))).))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table