Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA051795 Similarity: 0.973 Similarity: 0.972 Similarity: 0.972
UTR: 5HSAA051795
Gene: IFITM2
MFE: -24.408
ENS: 0.983
Length: 111.
Predicted Ligands:
SAM - 16/20
TPP - 2/20
methionine - 2/20
 RS: URS000085557B_146018
MFE: -37.112
Ligand: TPP
Species: Mycolicibacterium neworleansense TPP
 RS: URS0000C661A7_319501
MFE: -36.977
Ligand: SAM
Species: Brevibacillus sp. WF146 SAM riboswitch (S box leader)
 RS: URS0000D89D26_574375
MFE: -32.505
Ligand: SAM
Species: Bacillus gaemokensis SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA051795 URS000085557B_146018 URS0000C661A7_319501 URS0000D89D26_574375
Length 111. 112. 112. 111.
Similarity - 0.973 0.972 0.972
Ensemble Norm 0.983 - - -
MFE -24.408 -37.112 -36.977 -32.505
Ligands - TPP SAM SAM
Gene IFITM2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.029 11. 8.005
Length SE - 1. 1. 0.
Lev Distance - 34. 32. 35.
UBS 9. 9. 8. 8.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 1.
ILR 4. 3. 2. 2.
H 3. 3. 4. 4.
BL 3. 3. 1. 2.
BR 2. 1. 2. 1.
UN 0.234 0.062 0.232 0.162

Sequences

Field Description
UTR seq + 25 gaggaaacuguugagaaaacggaacuacuggggaaagggagggcucacugagaaccaucccgguaacccgaucaccgcuggucaccATGAACCACATTGTGCAAACCTTCT
UTR dot + 25 …….(((((…..)))))……((((..(.((((((.(((…)))..)).))))..)..))))………((((((.(((…..))).)))…)))….
RS 1 seq GACUGGCAAUACGGGAGCCCCGGGGACGUGGGGCUGAGAGUGGGCAUUCGGACCGGCCCUGACCGUCACACCUGAUCCGGGUCAUGCCGGCGAAGGGAGCGGAUAUGGCACU
RS 1 dot ….(((………)))(((((((((.(((((((.(..(((….)))..))))))))…))))……..)))))((((((((.((…….)))).))))))…
RS 2 seq ACCUUAUCCAGAGAGGCGGAGGGACUGGCCCGAUGAAGCCCGGCAGCGGAUCUGCCCGUACGGCGGCAGAUGCUGUGCCAAUUCCAGCAGGAGCAUUCCUGACAGAUAAGAA
RS 2 dot .((((…….))))((..(((…..)))..))……((((..(.((((((((…..).))))))).)..))))……..(((((….)))))………..
RS 3 seq CUCUUAUUGAGAGCGGUGGAGGGAAAGGCCCUGUGAAGCCCAGCAACCUUCAAACGAAAUGUUUGAAACGGUGCUAAUACCUGCAAAACGAAUUGUUUUGCAUGAUGAGAG
RS 3 dot (((…..))).((..((.((((…..)))).))..))..(((.((((((((((…..)))))))..))))))……((((((((…..))))))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table