Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA051797 Similarity: 0.965 Similarity: 0.965 Similarity: 0.965
UTR: 5HSAA051797
Gene: IFITM3
MFE: -29.433
ENS: 0.779
Length: 126.
Predicted Ligands:
SAM - 7/20
TPP - 5/20
cobalamin - 3/20
 RS: URS0000AB55F7_1049972
MFE: -33.906
Ligand: cobalamin
Species: Leptospira licerasiae serovar Varillal str. VAR 010 AdoCbl riboswitch
 RS: URS000232D999_1262914
MFE: -22.190
Ligand: cobalamin
Species: Phascolarctobacterium sp. CAG:207 Cobalamin riboswitch
 RS: URS0000DAE005_1798427
MFE: -34.647
Ligand: SAM
Species: Ignavibacteria bacterium GWC2_36_12 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA051797 URS0000AB55F7_1049972 URS000232D999_1262914 URS0000DAE005_1798427
Length 126. 127. 125. 127.
Similarity - 0.965 0.965 0.965
Ensemble Norm 0.779 - - -
MFE -29.433 -33.906 -22.190 -34.647
Ligands - cobalamin cobalamin SAM
Gene IFITM3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 13.003 11.001 7.006
Length SE - 1. 1. 1.
Lev Distance - 40. 41. 43.
UBS 10. 9. 10. 11.
BS 0. 0. 0. 0.
ILL 5. 5. 3. 5.
ILR 2. 3. 3. 3.
H 3. 2. 2. 3.
BL 1. 2. 3. 0.
BR 5. 2. 4. 3.
UN 0.183 0.126 0.152 0.102

Sequences

Field Description
UTR seq + 25 aggaaaaggaaacuguugagaaaccgaaacuacuggggaaagggagggcucacugagaaccaucccaguaacccgaccgccgcuggucuucgcuggacaccATGAATCACACTGTCCAAACCTTCT
UTR dot + 25 …………..(((….)))((((…(((((((…((..(((…((((.((….)).))))..)))..)).)).))))).)))).((((((…((…..)).))))))……..
RS 1 seq AAUUACGCUUUCAGGGAGGAAGUCGGGUGAAAAUCCCGCGCUGACCCGCAACUGUGAUGUCCGUCUAUACGGAAUAAGCCAGAUCUUCCCCGCGAUACUUAGACCUCGAGGUUGGGGGGUAUCGUAA
RS 1 dot ………….(((((((..((.(((…….(((.(..(((..(((…….)))..)))..).)))…..))).))))))))).((((((((….(((((….)))))))))))))..
RS 2 seq CUUAAUAAUUUUAUCAAAGGUGCCUCAAGGUUAAAUUAGGGAAGUCCGGUGUAAAUCCGGCACGGUCACGCCACUGUAAGCGCAUAUUGCGUAAGUCAGAUCGCAGCCUUUGAUUUUUGCCAUAU
RS 2 dot ……………….((((..((.(((…….(((..((((((…….)))).))..)).))))..))…))))((((.(((.((((((((……..)))))))).))).))))
RS 3 seq CUCUUAUCGAGAAAGGUCGAGGGAACAGGCCCUGUGAAACCUUGGCAACCAUUCAGGAUAAAAUCCUUGAAGCCGGUGCUACUUCCUGCCCCGUUCUGUUAUACAGAAAACGAGGGAAAGAUGAGAG
RS 3 dot .(((..((((……)))).))).((((….(((..(((..(((…..((((((((…))))).)))))))))..)))..))))(((((((((((…)))))..))).)))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table