Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA051833 Similarity: 0.993 Similarity: 0.993 Similarity: 0.993
UTR: 5HSAA051833
Gene: IFNK
MFE: -2.637
ENS: 0.688
Length: 48.
Predicted Ligands:
preQ_1 - 19/20
Ni/Co - 1/20

 RS: URS0000C28746_1423750
MFE: -7.320
Ligand: preQ_1
Species: Lactobacillus ghanensis DSM 18630 PreQ1 riboswitch
 RS: URS0000C11D39_1605
MFE: -7.279
Ligand: preQ_1
Species: Lactobacillus animalis PreQ1 riboswitch
 RS: URS0000AB6CC1_1229756
MFE: -6.034
Ligand: preQ_1
Species: Leuconostoc gelidum JB7 PreQ1 riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA051833 URS0000C28746_1423750 URS0000C11D39_1605 URS0000AB6CC1_1229756
Length 48. 48. 48. 48.
Similarity - 0.993 0.993 0.993
Ensemble Norm 0.688 - - -
MFE -2.637 -7.320 -7.279 -6.034
Ligands - preQ_1 preQ_1 preQ_1
Gene IFNK - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 0.004 0.004 0.007
Length SE - 0. 0. 0.
Lev Distance - 9. 9. 9.
UBS 1. 1. 1. 1.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 0.
H 1. 1. 1. 1.
BL 0. 0. 0. 0.
BR 0. 0. 0. 0.
UN 0.604 0.542 0.542 0.521

Sequences

Field Description
UTR seq + 25 ggauuuuuuagcuugcaaaaaaaATGAGCACCAAACCTGATATGATTC
UTR dot + 25 ……….((((………..))))……………….
RS 1 seq UGCCGGGUGGUUCGUAAACAUCCCACCGUAAUAAAAAACUAGGAGGAA
RS 1 dot …..(((((…………)))))…………………
RS 2 seq AUAUUGGUGGUUCGCAACCAUCCCACCGUAAUAAAAAACUAGGAGAGA
RS 2 dot …..(((((…………)))))…………………
RS 3 seq UUGAUAGCGGUUCAUCAACCAUCCCGCUUAUAAAAAAACUAGGAGAUU
RS 3 dot …..(((((………….)))))………………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table