Detected as a riboswitch by 7 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA051860 Similarity: 0.952 Similarity: 0.950 Similarity: 0.950
UTR: 5HSAA051860
Gene: IFT172
MFE: -64.393
ENS: 0.773
Length: 183.
Predicted Ligands:
Mn2+ - 12/20
cobalamin - 4/20
lysine - 2/20
 RS: URS0002313251_1712029
MFE: -38.295
Ligand: cobalamin
Species: Bacillus sp. FJAT-25509 Cobalamin riboswitch
 RS: URS0000AB6A35_573060
MFE: -86.855
Ligand: Mn2+
Species: Acidovorax delafieldii 2AN yybP-ykoY manganese riboswitch
 RS: URS0000AB273A_516466
MFE: -74.776
Ligand: FMN
Species: Burkholderia sp. H160 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA051860 URS0002313251_1712029 URS0000AB6A35_573060 URS0000AB273A_516466
Length 183. 182. 184. 184.
Similarity - 0.952 0.950 0.950
Ensemble Norm 0.773 - - -
MFE -64.393 -38.295 -86.855 -74.776
Ligands - cobalamin Mn2+ FMN
Gene IFT172 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.006 6.002 13.
Length SE - 1. 1. 1.
Lev Distance - 63. 62. 57.
UBS 15. 15. 15. 15.
BS 0. 0. 0. 0.
ILL 4. 4. 4. 6.
ILR 2. 2. 1. 4.
H 3. 3. 4. 3.
BL 6. 5. 6. 4.
BR 6. 6. 4. 5.
UN 0.060 0.137 0.016 0.082

Sequences

Field Description
UTR seq + 25 cuguuugcuucgccgcaaaguuacgugugaccuugcgacgcguguugcgcuccggucgcauaagcgucagugccugucgcugcggcugcguggcggguuguccagguaaccacgggaguugucgcugucuaggagcaucugaaagacaggugugcgucATGCACTTGAAGCACCTGAGGACCC
UTR dot + 25 ……….((((((((.((((….)))).)))))..))).(((((((…((((((…((((.(((…))).)))))))))))))))))(((((.(.(((((…..((((.((((.(((………(((((((…..)))))))))).)).)).))))….)))))).)))))
RS 1 seq AUUGAAUAGAUUAGGAUUGGUGCACAAUGAAAAUUGUGCUUAAUAGGGAAGUACGGUUUAAAUCCGUCACGGUACCCGCCACUGUAAGGGGAGUUCAUUGCAGAUGUCACUGAAGGAAUUUGGGAAGACGCAAUAGAAUGAUGAACCUAAGUCAGGAGACCUGCCUUUACCUAAUAGCUUCA
RS 1 dot ……………(((((.(((((((….)))))))))))).(((..((((((…….)))).))….)))….((((.(((((((……((((.(.((.((((…..((((((….((((……)).))..)))))))))))).).)))))))).))).))))…..
RS 2 seq GCGCCCGUCUCUGGGGAGUAGCCCGCCCGGCCGCACACGGCGCCGGGGGCUUGCGUCAACACACUUGGGUUCCCACAACCUAUGGCGCACGCGGCUUGUGAUGAGCUGGGCGAGACCAUUGACUGCAUGCCGAUCCAUUGGCCGGAGUCGGCGUGCGGUCAAUGCGUUCACCACCCAUCCGGCC
RS 2 dot ((.(((…….))).))((((..(((((.(((…..))))))))))))(((((((…….((((((…..)))))))))))))…(((.((.((((.(.(((..(((..((((((((((((((((((((…….))).)))))))))))))))))..))).))).))))))))))
RS 3 seq GUGCGUCUUCAGGGCGGGGUGAAAUUCCCCACCGGCGGUAGGCCGGCAGCGCGACAGCGCGAGCCGGCAAGCCCGCGAGCGCCCGCAUCGAGUCGUCUUCGGAGUGUUGGAGACAGCGGCGGGGUCAGCAGAUCUGGUCAGAAGCCAGAGCCGACGGUCACAGUCCGGAUGGAAGAAGAGGUGC
RS 3 dot …………((.((((…….)))).)).(((((..((((((.((((….))))..))))))..))).))..(((((….((…(((((..((((.(((….(((.(((((…………((((((…..)))))))))).).)))))).)))))))))..))…)))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table