Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA051909 Similarity: 0.946 Similarity: 0.941 Similarity: 0.940
UTR: 5HSAA051909
Gene: IFT74
MFE: -61.982
ENS: 0.903
Length: 188.
Predicted Ligands:
cobalamin - 12/20
FMN - 4/20
Mg2+ - 2/20
 RS: URS0000C2402E_33935
MFE: -49.713
Ligand: FMN
Species: Bacillus macroides FMN riboswitch (RFN element)
 RS: URS0002327D85_1262920
MFE: -52.774
Ligand: cobalamin
Species: Prevotella sp. CAG:1124 Cobalamin riboswitch
 RS: URS0000C120E5_1408226
MFE: -40.678
Ligand: Mg2+
Species: Vagococcus lutrae LBD1 M-box riboswitch (ykoK leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA051909 URS0000C2402E_33935 URS0002327D85_1262920 URS0000C120E5_1408226
Length 188. 188. 190. 187.
Similarity - 0.946 0.941 0.940
Ensemble Norm 0.903 - - -
MFE -61.982 -49.713 -52.774 -40.678
Ligands - FMN cobalamin Mg2+
Gene IFT74 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.004 3.008 11.
Length SE - 0. 4. 1.
Lev Distance - 68. 72. 72.
UBS 15. 15. 14. 14.
BS 0. 0. 0. 0.
ILL 2. 4. 2. 2.
ILR 2. 3. 3. 3.
H 5. 4. 4. 3.
BL 5. 4. 5. 6.
BR 6. 7. 6. 8.
UN 0.101 0.037 0.189 0.118

Sequences

Field Description
UTR seq + 25 aucccgcccccguugccgggauacgccgcggcgcacggcaguuaguggguaggccugagagccgaggaaaacugagcgugggccucagaaagaaguuaaggcacccgcgagccgggcaacugcccuccuuccgcgccggcggagcgauuaaagugaagaaacaATGGCCAGCAATCACAAATCTTCAG
UTR dot + 25 ………(((((((((((…..)).))))).))))..(((.((((((..(((((((.(((.(.(………).).)))))))…………))))))))).))).((((….))))((.((((((….)))))).))……((((((…..(((…….)))….)))))).
RS 1 seq AUUCAUCUUCGGGGCAGGGUGAAAAUCCCGACCGGCGGUAAUAGAGUUAUAAAUCGUUAAUGAUUUUUCAUUAACUUGAGAGGUUUAUGCUAAACUCUUCAGCCCGCGACCUGUGUAAAUUUAUUUGCAUGGCUGACUUGGUGUAAUUCCAAGGCCGACAGUUACAGUCUGGAUGGGAGAAGAUGGAG
RS 1 dot ….(((.((((..(.((((….)))).).)))).)))…(((((((((((((((((((((….))))))))……))))))))….)))))((((((……..(((((((….)))))))))))))(((.((.(..(((((…(((((…….))).)).)))))..).)).)))
RS 2 seq UAACUUUGCGACCAAUAAGGUUCGAUUUGCUCGAUCAAAAAGGGAACGGAGUGCAAGUCUCCGACUGUCUCGCAGCUGUUAGUUCCUUUAUGUCCAUCAAGCAAUGACACCACUGCCCCACUCCAACGGGGCGGGAAGGUGCUUGACGGCGGAACAUAGUCAGAAGACCUGCCUUAUUAUAAUGCCCACU
RS 2 dot ……..(((((…..))).))..(((((.(((((.(((((((((((..(((.((.(…….).)).))).))))…))))))).))…))).)))))…((((.(((((((……..)))))))…))))……(((((……(((….))))))))……………..
RS 3 seq AGAACAAUCUGUUAGGUGAGGCUCCUGUCUGGAAAUACGCUACUGCCCUCCAAUAAUCGAGAGAAUAUUGUGAUGAGUUUUUUAGGGUCAACUGAAAUUGUCGAACAAGGCUUUUUCUAAUGUAGCUGAUAGUGAUUAUUGACUAUCUAAGCCAUUCAGUGCUAAAACUCGACGUUGAGAUUUGGCG
RS 3 dot ……….((((((.((((((..(((.(((.(((……..(((((((((((.((….)).))))).))………..))))……..))).))).))).)))))).))))))…(((((((((.(….).))))))..)))……..((((((.((((….)))).)))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table