Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA051937 Similarity: 0.962 Similarity: 0.958 Similarity: 0.956
UTR: 5HSAA051937
Gene: IFT81
MFE: -42.719
ENS: 0.984
Length: 155.
Predicted Ligands:
glucosamine - 6/20
FMN - 5/20
cobalamin - 4/20
 RS: URS0000D9015A_1528693
MFE: -48.441
Ligand: cobalamin
Species: Burkholderia sp. AD24 AdoCbl riboswitch
 RS: URS0000C1A7C2_1108045
MFE: -63.
Ligand: FMN
Species: Gordonia rhizosphera NBRC 16068 FMN riboswitch (RFN element)
 RS: URS0000AB5247_340099
MFE: -53.840
Ligand: glucosamine
Species: Thermoanaerobacter pseudethanolicus ATCC 33223 glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA051937 URS0000D9015A_1528693 URS0000C1A7C2_1108045 URS0000AB5247_340099
Length 155. 155. 156. 155.
Similarity - 0.962 0.958 0.956
Ensemble Norm 0.984 - - -
MFE -42.719 -48.441 -63. -53.840
Ligands - cobalamin FMN glucosamine
Gene IFT81 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 6. 10.009
Length SE - 0. 1. 0.
Lev Distance - 49. 53. 55.
UBS 11. 12. 12. 11.
BS 0. 0. 0. 0.
ILL 5. 5. 5. 4.
ILR 1. 1. 3. 3.
H 3. 3. 3. 3.
BL 2. 4. 3. 3.
BR 4. 4. 4. 2.
UN 0.123 0.129 0.141 0.026

Sequences

Field Description
UTR seq + 25 guaacucuacggccuagcaaccguugccaaggagcucgacucugggagcggucuagagcccgggcgccuccugggggguggggaaacgguuucgugaggagaauuugaguuaaaauuauaagaccuaauuATGAGTGATCAAATTAAATTCATTA
UTR dot + 25 ….(((…(((((((..((((((.((..((((…..)))))).)))))))))).))).)))((((((….))))))………….(((((…(((((((.(((…((((((…….)))))).))))))))))…)))))..
RS 1 seq CGCGUAGAAUAGUGGCACUGCGAAGCUCGGAAGCCGGUGAAAGCCCGGCGCGGUCGCGCCACUGUAAUUGGCCUUUACUGCCAAAAGCCAGACCUGAGCUUGGCGCACUUCCUCUGUAAUCGACUAUCGGGGCGCGUUACCCCAGGAGAUGUCCG
RS 1 dot ……..((((((((…((((…(((…(((((.(….)))))).)))))))))))))))..(((((.(((……))).))))).((((.(..((((((….((((.(((……))).)))).))))))..)))))………
RS 2 seq CAGAGUUCUCGGGGCGGGGUGCAAUUCCCCACCGGCGGUGAUGGCGUCCACACGGGUGGUGCGUCGAGCCCGCGAGCGCCCGCCACAGCGGCGGGGUCAGCAGAUCCGGUGUGAAUCCGGAGCCGACGGUGACAGUCCGGAUGUGAGAGAACGGGG
RS 2 dot …….((((((((..((((((…..(((((.(..(((……..))).).)))))))))))..)))).))))(.((((((…..)))))))….((.((((((..((…(((…….)))…))..)))))).))………..
RS 3 seq AAAAUUUAAAAAGCGCCUGGGCUUAAAGUGUAUACUUUAAGCUGACGAGGACAGGGUUUAUCGAGUUAUCGGCGGGUGCCCUGCGGUUUCCUGCGACCGAUAAAGGACUGGUAAAACCACAGGCGACUGUGGCAUAGAGCAGUCUGGGCAGGGAG
RS 3 dot ..(((((…((((.((((((((((((((….))))))))))……..))))))))…)))))..(.(((((…))))).)((((((((..((……((((((.(….((((((….))))))…..).))))))))))))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table