Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA052015 Similarity: 0.969 Similarity: 0.968 Similarity: 0.968
UTR: 5HSAA052015
Gene: IFT88
MFE: -26.841
ENS: 0.977
Length: 121.
Predicted Ligands:
TPP - 5/20
molybdenum - 4/20
glycine - 4/20
 RS: URS0000BE8919_1314781
MFE: -47.655
Ligand: cobalamin
Species: Exidia glandulosa HHB12029 TPP riboswitch (THI element)
 RS: URS0000DA7347_1963862
MFE: -42.863
Ligand: molybdenum
Species: Marispirochaeta aestuarii Moco (molybdenum cofactor) riboswitch
 RS: URS0000AB2736_983920
MFE: -47.821
Ligand: glycine
Species: Novosphingobium nitrogenifigens DSM 19370 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA052015 URS0000BE8919_1314781 URS0000DA7347_1963862 URS0000AB2736_983920
Length 121. 120. 122. 120.
Similarity - 0.969 0.968 0.968
Ensemble Norm 0.977 - - -
MFE -26.841 -47.655 -42.863 -47.821
Ligands - cobalamin molybdenum glycine
Gene IFT88 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.008 5.006 5.011
Length SE - 1. 1. 1.
Lev Distance - 35. 39. 39.
UBS 10. 8. 9. 10.
BS 0. 0. 0. 0.
ILL 3. 2. 1. 3.
ILR 2. 2. 2. 2.
H 3. 2. 3. 3.
BL 4. 2. 4. 3.
BR 2. 1. 2. 4.
UN 0.165 0.075 0.090 0.058

Sequences

Field Description
UTR seq + 25 aaauaaaacggacaccuuaagcgcuacaaucaaggugcgcacggggugcuacagaacaauacgcagacaggaggagguggggggaaaggugagacuATGATGCAAAATGTGCACCTGGCTC
UTR dot + 25 ………((.((((((..((((.((…….))))))..))))))))………..(.((…………)).)(((..(((((..((.((……..)))).)))))..)))
RS 1 seq CAUCUUGGCUGCGGGUAUCCACCUCCCAGAGUCUGGUCUGGGCUGGGAGGUGGAUUGAGAUUAUACCGCCUGAACCUGAUCAGCGUUGACACCUGCGUAGGGAAGCCUCCCCCAGUGUCA
RS 1 dot …….((((((((((((((((((((((..((……)).)))))))))))))………………)))))..))))..(((((.(((.(..((((….)))))))))))))
RS 2 seq GUACAUAUAUAUCUCCGAUCCGAUUAACCUACAGGACGCCCGUCCCAGGGUUGUCGGACGCCAGGUCCCGAUGGAAACGUCUGUGCCUCCCGUAUUUGGAAAGGAGAAAAUACAGGGAGGUA
RS 2 dot ……….((((.((.(((((.((((((…((((….))))..)))))))))))))..)))).(.((((….)))).)((((((((((((((……….)))))).))))))))
RS 3 seq CAGUGAUGCUCUGGAAAGUGUACCGGGCUUUCGGCCCGGUGCCGCCGAAGGGGUAACUUCGCGGGUGUCGAAUCGCGCGCGUGGGGAAAACUCUCAGGUUUUCGCGACAGAGGGGGCUCC
RS 3 dot ……((((((((…(.((((((((((…))))))))))).))…)))))).((.((((.(((……))).)))).))(((…(((((..(((…..))).)))))…)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table