Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA052055 Similarity: 0.983 Similarity: 0.978 Similarity: 0.978
UTR: 5HSAA052055
Gene: IGF2BP2
MFE: -22.246
ENS: 0.887
Length: 105.
Predicted Ligands:
SAM - 11/20
glycine - 7/20
cyclic-di-GMP - 1/20
 RS: URS0000DAC415_1793963
MFE: -26.831
Ligand: SAM
Species: Bacillus nakamurai SAM riboswitch (S box leader)
 RS: URS0000512FC8_1150476
MFE: -27.856
Ligand: SAM
Species: Bacillus velezensis UCMB5113 SAM
 RS: URS0000A08CFB_326423
MFE: -27.656
Ligand: SAM
Species: Bacillus amyloliquefaciens FZB42 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA052055 URS0000DAC415_1793963 URS0000512FC8_1150476 URS0000A08CFB_326423
Length 105. 105. 105. 105.
Similarity - 0.983 0.978 0.978
Ensemble Norm 0.887 - - -
MFE -22.246 -26.831 -27.856 -27.656
Ligands - SAM SAM SAM
Gene IGF2BP2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 11. 11.
Length SE - 0. 0. 0.
Lev Distance - 21. 25. 25.
UBS 7. 9. 10. 10.
BS 0. 0. 0. 0.
ILL 4. 3. 4. 4.
ILR 2. 2. 2. 2.
H 1. 1. 1. 1.
BL 2. 3. 3. 3.
BR 3. 3. 4. 4.
UN 0.019 0.038 0.038 0.038

Sequences

Field Description
UTR seq + 25 ccccgcgggcuugaucuaagcaagguucugagugcuuuaauuucuguuuuaaagguaaaguggaauugcaugggaaaaucATGATGAACAAGCTTTACATCGGGA
UTR dot + 25 .((((.(((((((.((………((((..((((…((((((..(((((….))))).)))))))))).))))………)).)))))))…..)))).
RS 1 seq AACUUAUCAAGAGCGGCUGAGGGACUGGACCGAUGACGCCCGGCAACCUGCAUAUGAUGCAAGGUGCCGCAUCCAGAAAAAUGCAUGUCAUUUUGAAGAUAAGGG
RS 1 dot ..((((((.((((.(((((…..(((((….((…..((((.((((((((…))))).))))))))))))))…….)).))).))))…))))))..
RS 2 seq AGCUUAUCAAGAGCGGCUGAGGGACUGGACCGAUGACGCCCGGCAACCUGCGUGUCAUGCAAGGUGCCGCAUCCAGAAAAAUGCACAGCAUUUUGAAGAUAAGGG
RS 2 dot ..((((((.((((..((((..(.((((((….((…..((((.((((((((…))))).))))))))))))))…..).).)))).))))…))))))..
RS 3 seq AGCUUAUCAAGAGCGGCUGAGGGACUGGACCGAUGACGCCCGGCAACCUGCGUGUAUUGCAAGGUGCCGCAUCCAGAAAAAUGCACAGCAUUUUGAAGAUAAGGG
RS 3 dot ..((((((.((((..((((..(.((((((….((…..((((.(((((((…..)))).))))))))))))))…..).).)))).))))…))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table