Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA052057 Similarity: 0.981 Similarity: 0.980 Similarity: 0.979
UTR: 5HSAA052057
Gene: IGF2BP2_0
MFE: -17.724
ENS: 0.958
Length: 95.
Predicted Ligands:
Ni/Co - 9/20
glycine - 6/20
TPP - 2/20
 RS: URS0000C0A6A3_1609098
MFE: -30.373
Ligand: TPP
Species: Streptomyces sp. NRRL F-5122 TPP riboswitch (THI element)
 RS: URS000227B08D_424218
MFE: -28.412
Ligand: glycine
Species: Georgfuchsia toluolica Glycine
 RS: URS0000C09435_658085
MFE: -29.381
Ligand: Ni/Co
Species: Lachnospiraceae bacterium 5_1_57FAA NiCo riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA052057 URS0000C0A6A3_1609098 URS000227B08D_424218 URS0000C09435_658085
Length 95. 95. 95. 96.
Similarity - 0.981 0.980 0.979
Ensemble Norm 0.958 - - -
MFE -17.724 -30.373 -28.412 -29.381
Ligands - TPP glycine Ni/Co
Gene IGF2BP2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 3.005 3.005
Length SE - 0. 0. 1.
Lev Distance - 24. 26. 26.
UBS 8. 8. 8. 7.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 0.
ILR 0. 0. 1. 1.
H 4. 4. 4. 4.
BL 2. 4. 2. 2.
BR 2. 3. 1. 1.
UN 0.105 0.116 0.179 0.177

Sequences

Field Description
UTR seq + 25 aggcuaagggagagauagcuaaugaccgguauuguguacugagaucagacuucagggaugaagcagcuguATGATGAACAAGCTTTACATCGGGA
UTR dot + 25 .(((((………)))))..((((((((((…)))))).).)))..(((((….)))))…(((.(((.((((…..))))))))))..
RS 1 seq GUACCGGACACGGGGUGCCCCAUCUGCGGGCUGAGAUCACACCCGUUGAACCUGAACCAGUUCGUACUGGCGGAGGGAUGUCUUUCAUGCCAUUG
RS 1 dot (((((……..)))))….((.(((((.((……))))))).))…….(((((….)))))(((.((.(((…..))).)).)))
RS 2 seq GCUCCAUCGUCGGGAGAGAACAGGUAGCGCAGCAUGCCUGUCGCCGAAGGCGCAACCCCCAGGAAUCGCUCAGGCAAAAGGGCCGACGACGCAGU
RS 2 dot .((((…….))))…(((((((((…)).)))))))((((…))))……….(..(((.((.(((……))))))))..)…
RS 3 seq ACAGUACAAACUGAGCAGGCGAUGAACCUUUAGGUCAUGGGGCCGGGCCGCUUUUGUGGCAGCAGAUUGCAAUUUCAGCACAUCUGUGGGACAGUU
RS 3 dot .((((….))))….(((.(((.(((….))))))…)))..(((((….))))).(((((((((…….))).))))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table