Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA052144 Similarity: 0.971 Similarity: 0.971 Similarity: 0.970
UTR: 5HSAA052144
Gene: IGSF5
MFE: -23.761
ENS: 0.791
Length: 128.
Predicted Ligands:
TPP - 14/20
SAM - 6/20

 RS: URS0000D823BC_1797235
MFE: -35.137
Ligand: TPP
Species: Acinetobacter sp. RIFCSPHIGHO2_12_41_5 TPP riboswitch (THI element)
 RS: URS0000ABC9BF_3821
MFE: -38.537
Ligand: TPP
Species: Cajanus cajan (pigeon pea) TPP riboswitch (THI element)
 RS: URS0000D809F6_1582270
MFE: -35.487
Ligand: TPP
Species: Acinetobacter populi TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA052144 URS0000D823BC_1797235 URS0000ABC9BF_3821 URS0000D809F6_1582270
Length 128. 128. 128. 128.
Similarity - 0.971 0.971 0.970
Ensemble Norm 0.791 - - -
MFE -23.761 -35.137 -38.537 -35.487
Ligands - TPP TPP TPP
Gene IGSF5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 4. 2.
Length SE - 0. 0. 0.
Lev Distance - 38. 38. 40.
UBS 8. 8. 7. 8.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 1.
ILR 3. 3. 3. 3.
H 3. 4. 4. 4.
BL 1. 2. 1. 1.
BR 1. 1. 0. 1.
UN 0.219 0.219 0.219 0.219

Sequences

Field Description
UTR seq + 25 accauuaguaccuaggaggcagggaucagaggaaguagauucagagguaaggagaauuuuggggcuauacuuucaagaaagucguguucgggacccaggagguATGGGTCAGAAGGAAAGGAGCACAG
UTR dot + 25 ……….(((.(….))))…….((((((((..((((((……….))))))..))..))))))………((((((..((((((…….)))))).))………))))..
RS 1 seq CAUCGCUUGACGGAGCGCGAGUAAUUGCUCGCUGAGAUCAGCUAAUACUUUUCAAUAAAGUUUUGAAGCUGAGUACCGUUGAACCUGAUCAGGUUAAGACCUGCGUAGGAAUCAAGCCAUCUAAAAAC
RS 1 dot ….((((….))))((((((….))))))…..((((((((.(((((…..))))).))..))))))……((((.((((..(((((….)))))..))))..))))………….
RS 2 seq CAUCGCUUGACGGAGCGCGAGUAAUUGCUCGCUGAGAUCAGCUAAGACUUUUCAAUAAAGUUUUGAAGCUGAGUACCGUUGAACCUGAUCAGGUUAAGACCUGCGUAGGAAUCAAGCCAUCUAAAAAC
RS 2 dot ….((((….))))((((((….))))))…..((((((((((((((…..))))))))..))))))……((((.((((..(((((….)))))..))))..))))………….
RS 3 seq CAUCGCUUGACGGAGCGCAGUUAACGAACUGCUGAGAUCGCAUAAGUUGUCUUUUGAUCAACUUGAAUGUGAGUACCGUUGAACCUGAUCAGGUUAAGACCUGCGUAGGAAUCAAGCCAUCUAAAAAC
RS 3 dot ….((((….))))((((((….))))))…..((((((((((((((….)).))))))..))))))……((((.((((..(((((….)))))..))))..))))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table