Detected as a riboswitch by 7 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA052164 Similarity: 0.968 Similarity: 0.967 Similarity: 0.966
UTR: 5HSAA052164
Gene: IK
MFE: -41.591
ENS: 0.843
Length: 135.
Predicted Ligands:
cobalamin - 11/20
FMN - 7/20
zmp-ztp - 1/20
 RS: URS0002313D33_146922
MFE: -48.659
Ligand: cobalamin
Species: Streptomyces griseofuscus Cobalamin riboswitch
 RS: URS0000AB9380_161544
MFE: -39.256
Ligand: FMN
Species: Bacillus sp. SG-1 FMN riboswitch (RFN element)
 RS: URS0002314F96_1571774
MFE: -47.193
Ligand: cobalamin
Species: Streptomyces sp. RSD-27 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA052164 URS0002313D33_146922 URS0000AB9380_161544 URS0002314F96_1571774
Length 135. 135. 137. 134.
Similarity - 0.968 0.967 0.966
Ensemble Norm 0.843 - - -
MFE -41.591 -48.659 -39.256 -47.193
Ligands - cobalamin FMN cobalamin
Gene IK - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8. 6. 7.
Length SE - 0. 4. 1.
Lev Distance - 39. 36. 41.
UBS 13. 12. 13. 12.
BS 0. 0. 0. 0.
ILL 7. 6. 5. 6.
ILR 5. 4. 4. 4.
H 2. 2. 2. 2.
BL 3. 1. 3. 3.
BR 6. 5. 5. 4.
UN 0.022 0.015 0.029 0.015

Sequences

Field Description
UTR seq + 25 acgcaaagcaguguggguugauucugaggugcacugugggaaagagcuugucgcugcgguguugcuguuggagacucgauuguuggugacagcgaaagaacgauaacaaaATGCCGGAGCGAGATAGTGAGCCGT
UTR dot + 25 .((((..(((.(..(((…..)))..).)))..))))((…..((((.(((((.(((((((..(((((..(..((..((((((….))))))..)).)..))))).))))))).))))).).)))…))..
RS 1 seq CACUAGAUGUAUGCUCAUGGUCGCUGUCGUCGCAGGGGAAUCCGGUGCGAAUCCGGAACUGUCCCGCAACGGUGUACUUGUGCGUAUCCGCGCACAGGAAUCAGUCCGAGGACCUGCCGGCAGCGCACCCGGCCC
RS 1 dot ..((.((((…((……..))…))))..))(((…((((((((…((((….((((((..(((((…(((((((((….))))))))).))).)).)).))))…))))…))))).))))))
RS 2 seq AUUCGUCUUCGGGGCAGGGUGUAAUUCCCGACCGGCGGUAAUGAAUGAUUUCAUUCUAAGCCCGCGAGCCUGUUGUUUGGGCAGGAUUUGGUGAGAUUCCAAAGCCGACAGUAUAGUCUGGAUGGGAGGAGAUGAAG
RS 2 dot ((((((..(((.((..(((…….)))..))..)))..))))))…((((((((…(((((.((.((((((((..(((….(((((…….))))))))))))..)))).)).).)))).)))).)))).
RS 3 seq CCCCACAUGUAUGCUCAUGGCUGCUGCCGCCGCAGGGGAAUCCGGUGGGAAUCCGGAACUGUCCCGCAACGGUGUGACGUACGCCGAACGGUGUAUCCGCGAGUCCGAAGACCUGCCGGCAGUACCCCCGGAUC
RS 3 dot ((((…….(((…((((….))))..))))))).((((((.(((.((((((….(((.((..((..((((..(((((((….))))))).)))).)).))..)))…))))..)).))))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table