Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA052165 Similarity: 0.962 Similarity: 0.961 Similarity: 0.957
UTR: 5HSAA052165
Gene: IK_0
MFE: -47.425
ENS: 0.926
Length: 155.
Predicted Ligands:
cobalamin - 13/20
FMN - 5/20
TPP - 2/20
 RS: URS0000AB43F0_272560
MFE: -63.111
Ligand: cobalamin
Species: Burkholderia pseudomallei K96243 Cobalamin riboswitch
 RS: URS0002312E6B_1160710
MFE: -61.271
Ligand: FMN
Species: Microbacterium laevaniformans OR221 FMN riboswitch (RFN element)
 RS: URS000232B4D8_518642
MFE: -66.648
Ligand: cobalamin
Species: Streptomyces nanshensis Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA052165 URS0000AB43F0_272560 URS0002312E6B_1160710 URS000232B4D8_518642
Length 155. 154. 155. 155.
Similarity - 0.962 0.961 0.957
Ensemble Norm 0.926 - - -
MFE -47.425 -63.111 -61.271 -66.648
Ligands - cobalamin FMN cobalamin
Gene IK - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.001 14.001 15.002
Length SE - 1. 0. 0.
Lev Distance - 44. 45. 49.
UBS 12. 15. 13. 15.
BS 0. 0. 0. 0.
ILL 5. 6. 4. 5.
ILR 3. 3. 1. 5.
H 2. 2. 4. 2.
BL 4. 5. 2. 5.
BR 6. 6. 6. 7.
UN 0.058 0.032 0.090 0.013

Sequences

Field Description
UTR seq + 25 aggaagcggaaaggcugcgaacgcaaagcaguguggguugauucugaggugcacugugggaaagagcuugucgcugcgguguugcuguuggagacucgauuguuggugacagcgaaagaacgauaacaaaATGCCGGAGCGAGATAGTGAGCCGT
UTR dot + 25 ……((((((.(((((………))))).)…….))))).(((.(((((…………(.(((((.(((((((..(((((..(..((..((((((….))))))..)).)..))))).))))))).))))).)))))).)))..
RS 1 seq AACGGGAAACAGGAAGCGGUGCGCCCGCGCAACCUGUGCUGCCCCCCGCAACGGUAAGCCGCCUGCGACGCGCGCGUCGCGCAUCCCGCCCUCACGGCCACUGUCCUCGCGGAUGGGAAGGCGGCGGGACGGCACGCGGCCAGCCCGGAUACCG
RS 1 dot ..((((…(((…((((((((….)))).)).)).)))…))))…(((((..(((…((…((.(((((.((.(.(((((((……(((.((((((….))))))…)))))))))).))))))))))..)).))).)))))
RS 2 seq AAACGUGCUCCGGGGUCGGUGUGAAUCCGAACCGGCGGUGACUGUCCGCGAGCCCCUCUCACGAGGGGUUGAUCCGGUGGAAUUCCGGGACCGACGGUGAUGCGUGACGGUUCGACAGAACCCGAUCGCUAGUCCGGAUGGGAGGCAGCACGGAC
RS 2 dot ……….(((..((((…….)))).)))((((…….)))).((((((((….))))))))..((((((.(..(((((…(((((((((((.((….(((((….))))))))))))).))).)).)))))..).)).)))).
RS 3 seq ACCGGGGUACCUUCCGGUCGUAUCGAUCGACGACGGCAGGGCGGAAGCCGGUGGGAUUCCGGCGCGGUCGCGCCACUGUAUGCCCCCUACGGUCCGCUGCCGUGUGCAGCGUACGGGCAGGGGCGAGCCAGACCCGCGAGCCGUCACGAGCUCCA
RS 3 dot (((((…..((((((.((((.(((…..)))..)).)).))))))))))).(((…((..(((((((((…((((.((((((…(.((.((((((…..)))))).)).)…)))))).)).))…))))).))))..))…))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table