Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA052291 Similarity: 0.965 Similarity: 0.963 Similarity: 0.962
UTR: 5HSAA052291
Gene: IL10RA
MFE: -32.619
ENS: 0.
Length: 145.
Predicted Ligands:
FMN - 12/20
glycine - 3/20
cobalamin - 2/20
 RS: URS0000AB2AF2_398579
MFE: -37.407
Ligand: glycine
Species: Shewanella pealeana ATCC 700345 Glycine riboswitch
 RS: URS0000C330B8_1736287
MFE: -45.413
Ligand: glycine
Species: Burkholderia sp. Leaf177 Glycine riboswitch
 RS: URS0000D8C195_1797586
MFE: -53.161
Ligand: FMN
Species: Caulobacterales bacterium RIFCSPHIGHO2_12_FULL_68_13 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA052291 URS0000AB2AF2_398579 URS0000C330B8_1736287 URS0000D8C195_1797586
Length 145. 146. 144. 144.
Similarity - 0.965 0.963 0.962
Ensemble Norm 0. - - -
MFE -32.619 -37.407 -45.413 -53.161
Ligands - glycine glycine FMN
Gene IL10RA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 2.007 14.011
Length SE - 1. 1. 1.
Lev Distance - 43. 48. 43.
UBS 11. 11. 11. 13.
BS 0. 0. 0. 0.
ILL 3. 2. 3. 4.
ILR 1. 3. 2. 3.
H 3. 3. 3. 3.
BL 4. 5. 4. 6.
BR 4. 4. 5. 5.
UN 0.152 0.164 0.069 0.049

Sequences

Field Description
UTR seq + 25 gggaaggauagagaaguaugcgcaaggccaaacccccaacccgcaaaccucaucauccacccacuucuagaugagccguaaguuuagcucuagguuuuuugcuguuuagguucaaaugauATGCTGCCGTGCCTCGTAGTGCTGC
UTR dot + 25 (((..((((.((((.((.((((…((……..))….)))).)).)).)))))).)))………((((((.((((..((((…………))))))))))))))……..(((((……..)))))…..
RS 1 seq GGACGAGCCUCUGGAGAGACUGUGAGCAGCUAAGUGUUCGUAAGCUUAAUUGUCACACAGCGCCGAAGGCGAAAGUGUAAACUCAGCUAUUAAACCUAGCUAUGAGGUUACGCGAAACGCUCAGGCAAAAGGACAGAGGAGAGGAU
RS 1 dot ……((((.(((…(.(((((.((((.(((((……..))))).))))..)))))).))).))))….(((((..((((((((…….)))))..)))..)))))……(((.(………).)))……..
RS 2 seq AAAUCGCACUCUGGAGAGCGGCAUCGGCUGAUCAAGAAGUAGCAGCCAGUUGCCCACCGAAGGGGCGCGCGUUGGAAGUCGAAGAAGUCGAACAUCGGCUGAACAACGUGCAAUCUCUCAGGUACCGAGGACAGAGGGGUCAUG
RS 2 dot …..((.((((((.(.(((((…(((((…………))))).))))).).))..))))))((((((((..((((((.(……..).))))))…)))))))).(((((((..((…….)).)))))))….
RS 3 seq CAGUGUUCUCAGGGCGGGGUGCAAUUCCCCACCGGCGGUAAGGCGGCGACGCCAAGCCCGCGAGCGCUCCCCCGGCUUGGGGAGGUCAGCAGAUCCGGUGUGAUUCCGGGGCCGACGGUAUAGUCCGGAUGAAAGAGAACGGGA
RS 3 dot .(((((((.(.((((..((((….((.((.((……..)).)).))))))..))))).)))))))((..((((((.((((…((.(……).))…)))).))))))..))…..((((…………)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table