Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA052337 Similarity: 0.962 Similarity: 0.962 Similarity: 0.959
UTR: 5HSAA052337
Gene: IL13RA2
MFE: -38.330
ENS: 0.925
Length: 150.
Predicted Ligands:
cobalamin - 9/20
FMN - 8/20
tetrahydrofolate - 1/20
 RS: URS00023210C8_999541
MFE: -45.531
Ligand: cobalamin
Species: Burkholderia gladioli BSR3 Cobalamin riboswitch
 RS: URS0000C12C8C_1450761
MFE: -46.291
Ligand: FMN
Species: Aneurinibacillus sp. XH2 FMN riboswitch (RFN element)
 RS: URS0000C2784F_1408103
MFE: -40.866
Ligand: FMN
Species: Bacillus campisalis FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA052337 URS00023210C8_999541 URS0000C12C8C_1450761 URS0000C2784F_1408103
Length 150. 151. 149. 150.
Similarity - 0.962 0.962 0.959
Ensemble Norm 0.925 - - -
MFE -38.330 -45.531 -46.291 -40.866
Ligands - cobalamin FMN FMN
Gene IL13RA2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 21.014 7. 18.005
Length SE - 1. 1. 0.
Lev Distance - 41. 47. 48.
UBS 8. 11. 9. 11.
BS 0. 0. 0. 0.
ILL 3. 4. 2. 5.
ILR 2. 5. 2. 2.
H 2. 1. 2. 1.
BL 2. 3. 3. 2.
BR 2. 2. 4. 4.
UN 0.113 0.232 0.114 0.040

Sequences

Field Description
UTR seq + 25 guaagaacacucucgugagucuaacggucuuccggaugaaggcuauuugaagucgccauaaccuggucagaagugugccugucggcggggagagaggcaauaucaagguuuuaaaucucggagaaATGGCTTTCGTTTGCTTGGCTATCG
UTR dot + 25 ……..((((….))))…..((((…((((((((((((((((………..((((((((…..((.(((((.((……..)).))))))))))).))))………….))))))))))))))))…))))….
RS 1 seq AGCAACACAAAACCAGACGAAUCCCCAUAAACGAACGACGAAUCGUGGAAGCCGGUGUAAAUCCGGCGCGAUCGCGCCGCUGUGACCGUUCGCGUCGGCCUCGCGCCCGCGCGACGGAAGCCAGACCUCCCUUCGUCGUGAAGAUCGGACC
RS 1 dot ………………………….(((((((((((..(.(((….(((.(…(((((((((..(((((((.(((((….))))).))))…)))..)))))..))))….).)))))))))))))))…..)))….
RS 2 seq ACAAACCUUCAGGACAGGGUGAAAUUCCCGACCGGCGGUGAUGGAGCCAAUUCUCCUCAGUCCGCGACCCGGAUGCAAAAUGGCGAGCAUCCGGCUGACCCGGUGAAAUUCCGUGACCGACAGUAUAGUCUGGAUGGGAGAAGGGAGAA
RS 2 dot ….(((((……)))))….((((((.((((((((.((((((….(((.((((((……..((((((((……….))))))))))))…)).))).)))))).))))……….)))).))))))………
RS 3 seq AUAUUCCUUCGGGGUCGGGUGCAAUUCCCAACCGGCGGUGAUGAAGUGAGCGAGUGCUUCUUAGUCCGUGACCCGGUUAACUUACGUUAAGCGGUGGAUCUGGUGAAACUCCAGGGCCGACAGUAAAAGUCUGGAUGGGAGAAGGAAAAA
RS 3 dot …(((((((……………(((((.((((((((..((……..((((..(((((((((((….(((.(((((….))))).))))))).)))).)))))))))..))))………..)))).))))))))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table