Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA052673 Similarity: 0.979 Similarity: 0.979 Similarity: 0.979
UTR: 5HSAA052673
Gene: IL33
MFE: -12.070
ENS: 0.792
Length: 90.
Predicted Ligands:
SAM - 7/20
TPP - 7/20
zmp-ztp - 2/20
 RS: URS000232A65D_12908
MFE: -15.347
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
 RS: URS0000C08330_1017270
MFE: -19.254
Ligand: zmp-ztp
Species: Bacillus sp. NIOC03 ZMP/ZTP riboswitch
 RS: URS0000C87AAC_1783518
MFE: -33.773
Ligand: fluoride
Species: Halomonadaceae bacterium T82-2 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA052673 URS000232A65D_12908 URS0000C08330_1017270 URS0000C87AAC_1783518
Length 90. 89. 90. 90.
Similarity - 0.979 0.979 0.979
Ensemble Norm 0.792 - - -
MFE -12.070 -15.347 -19.254 -33.773
Ligands - cobalamin zmp-ztp fluoride
Gene IL33 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.018 10. 2.006
Length SE - 1. 0. 0.
Lev Distance - 25. 25. 28.
UBS 4. 4. 6. 5.
BS 0. 0. 0. 0.
ILL 1. 2. 3. 1.
ILR 1. 2. 1. 1.
H 3. 1. 2. 4.
BL 0. 0. 1. 0.
BR 0. 0. 0. 0.
UN 0.156 0.022 0.133 0.233

Sequences

Field Description
UTR seq + 25 acagaugccaaacgagauggagagagggugaguaggagcaaaauuucucaugagaauacugaaaaATGAAGCCTAAAATGAAGTATTCAA
UTR dot + 25 …….(((…….))).((((((….((….))….))))))….(((((((…………………)))))))..
RS 1 seq AUACUGAAUCAUGGUGGGGAACAAUGUGAAAUUCAUUGACUGUUCCUGCAACGGUAAAAGUAAAAUUGAGUCCGAGUGCCACCCAGUAA
RS 1 dot .(((((……(((((((((((..((((…))))….))))))…………………………..)))))))))).
RS 2 seq AAUAAAAGCAGCAACUGACGAGAGCGUGUGGAAUUGACCACAAGGAAGCUGCAAGAAUCACCUAAAAAGCCGUUCGUCUGGGCAGGGGUA
RS 2 dot …….(((((..((……….(((((……)))))))…)))))….(((.(((…..(((………))))))))).
RS 3 seq UAUCGCCCGGGAGAUGGCAUGCCUCCCGGCGGCACGGUGUUUCCGGCCCGCCAAACCACCGUACUCACGGUUAAUGAUGCCUGCGAGGCG
RS 3 dot ……..(((((………)))))(((((..(((…..)))..)))))…..(((((….)))))…….((((…)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table