Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA052677 Similarity: 0.984 Similarity: 0.981 Similarity: 0.981
UTR: 5HSAA052677
Gene: IL33_0
MFE: -14.199
ENS: 0.912
Length: 98.
Predicted Ligands:
purine - 10/20
TPP - 7/20
glycine - 2/20
 RS: URS0000AB9359_717962
MFE: -26.287
Ligand: purine
Species: Coprococcus catus GD/7 Purine riboswitch
 RS: URS0000C5FD6E_1276920
MFE: -28.233
Ligand: SAM
Species: Paeniglutamicibacter gangotriensis Lz1y SAM riboswitch (S box leader)
 RS: URS0000C2C64A_1140002
MFE: -13.477
Ligand: purine
Species: Enterococcus avium ATCC 14025 Purine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA052677 URS0000AB9359_717962 URS0000C5FD6E_1276920 URS0000C2C64A_1140002
Length 98. 98. 97. 98.
Similarity - 0.984 0.981 0.981
Ensemble Norm 0.912 - - -
MFE -14.199 -26.287 -28.233 -13.477
Ligands - purine SAM purine
Gene IL33 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.002 6. 7.010
Length SE - 0. 1. 0.
Lev Distance - 21. 23. 24.
UBS 4. 4. 4. 6.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 1.
ILR 1. 1. 2. 2.
H 2. 3. 2. 2.
BL 2. 1. 0. 2.
BR 0. 0. 0. 1.
UN 0.265 0.306 0.268 0.163

Sequences

Field Description
UTR seq + 25 aaauacuacaauugcugacuacaggaaaccucaucaucugagaccagcacuuuauaaauuagaauacugaaaaATGAAGCCTAAAATGAAGTATTCAA
UTR dot + 25 …………(((((.((.((((………..))))))..)))))…………(((((((…………………)))))))..
RS 1 seq AAAAUAAAUAUAUCAAUGGAUUAUAUAUGUUCAUAAUCAGGUUGAGCGUUUCUACCGGCUGCCGUAAACAGCCGACUAUAAUUCCCGAAGGCGGGAGA
RS 1 dot …………(((((.((((((……..))))))..)))))……….((((((…….))))))…….((((((….)))))).
RS 2 seq CAACCAUCCAGAGCGGCCGAGAGAUCUGGCUCGAUGACGCCGCAGCAACCCCUCCCCUUCAUUGGGCGGUAGGUGCUCACGCCAGAACCGAUGGAGA
RS 2 dot …………(((((((((……..))))…..)))))………….(((((((((……((((….))))….))))))))).
RS 3 seq AAUUUUCAUUAGAAGUGAACUUAUAUAUCGUCAUAAUAUGGUUGACAGUUUCUACCUUGUGCCGUAAACGCAAGACUAUAAGUAAAAAUCGUACGGUG
RS 3 dot ………(((((((.((((.((((………)))))))).))…)))))……((((((……..(((…)))……..)))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table