Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA053268 Similarity: 0.968 Similarity: 0.967 Similarity: 0.966
UTR: 5HSAA053268
Gene: INTS1
MFE: -68.072
ENS: 0.855
Length: 130.
Predicted Ligands:
cobalamin - 7/20
TPP - 4/20
zmp-ztp - 2/20
 RS: URS0000C2DB7F_1681197
MFE: -53.862
Ligand: TPP
Species: Arthrobacter sp. RIT-PI-e TPP riboswitch (THI element)
 RS: URS0000D83D4A_134849
MFE: -59.592
Ligand: methionine
Species: Cryptosporangium aurantiacum S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000C45F2A_766499
MFE: -44.684
Ligand: FMN
Species: Citreicella sp. 357 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA053268 URS0000C2DB7F_1681197 URS0000D83D4A_134849 URS0000C45F2A_766499
Length 130. 130. 132. 130.
Similarity - 0.968 0.967 0.966
Ensemble Norm 0.855 - - -
MFE -68.072 -53.862 -59.592 -44.684
Ligands - TPP methionine FMN
Gene INTS1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.001 9. 9.
Length SE - 0. 4. 0.
Lev Distance - 39. 34. 40.
UBS 13. 13. 12. 13.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 2.
ILR 2. 3. 2. 2.
H 3. 3. 3. 4.
BL 7. 5. 5. 5.
BR 7. 6. 5. 5.
UN 0.077 0. 0.091 0.092

Sequences

Field Description
UTR seq + 25 aucgguuuccgauuccgggguggccggguggcggcggcggcgcuccggucgcgaugggccagaggugacgccgcagccgccgggagccgcgagggacggggcaggATGAACCGGGCCAAGCCCACCACGG
UTR dot + 25 (((((…)))))..((.(((..((.((((((.((((((.(((((.((((……)))).))).)).)))))).)))))).)).))).)).(((.(..(((.((…..))..)))..))))…….
RS 1 seq UAGUGGUUCCACGGGAGCCCGGGAGCGUCGGCAGCACAUCGGCGGCGCGAGGGGCUGAGAGGGCGUUCGGCGCCGACCGUAUGAACCUGAACCGGUUGAUCCCGGCGUAGGAAGGACACGCAUGAGCUCG
RS 1 dot ….((((((…))))))(((((.((.((((((..(((((((((((((((.(.((….)).).)))).))))).))).)))…)))..)))..)).)))))((((.(……)))))………
RS 2 seq GGUCACGAGUGCCAACGCAGAGCCCCGGCUUGCCGGCCGGCAACCCUCCGUUCGCGGGCGGGGUGCUCCGGCAUGGUGAUGCCUGCGCGUCUGCGGUGUCCUUGGUGGACUCCCGUAGAGUGAGCGUCGAUU
RS 2 dot (((…….)))..(((((.((..((.(.((((((..((((.(((((((….)))).))).)))))))))).).))..)))))))(((((((((.((((…..))))..))))))).))……….
RS 3 seq GCGCAUUCUCAGGGCGGGGUGAAAUUCCCCACCGGCGGUGACAGUCCGCGAGCGCCAUCAUGCCGAUGGGUCAGCAGAGCCGGUGGAAUUCCGGGACCGACGGUGAAAGUCCGGACGGGAGAGAAAGGGG
RS 3 dot ((.(…….).)).(((……)))(((((((((.((((…(((((.(((……))))).))))))).)…))))))))..((((.(..(.(((…….))).)..).))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table