Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA053375 Similarity: 0.977 Similarity: 0.976 Similarity: 0.976
UTR: 5HSAA053375
Gene: INTS9
MFE: -27.354
ENS: 0.893
Length: 105.
Predicted Ligands:
glycine - 19/20
TPP - 1/20

 RS: URS0000DAB9D4_1965603
MFE: -29.182
Ligand: glycine
Species: Blautia sp. An249 Glycine riboswitch
 RS: URS0000AB583F_401526
MFE: -32.527
Ligand: glycine
Species: Thermosinus carboxydivorans Nor1 Glycine riboswitch
 RS: URS0000AB74E5_657308
MFE: -33.609
Ligand: glycine
Species: Gordonibacter pamelaeae 7-10-1-b Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA053375 URS0000DAB9D4_1965603 URS0000AB583F_401526 URS0000AB74E5_657308
Length 105. 104. 104. 105.
Similarity - 0.977 0.976 0.976
Ensemble Norm 0.893 - - -
MFE -27.354 -29.182 -32.527 -33.609
Ligands - glycine glycine glycine
Gene INTS9 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.014 7.008 6.
Length SE - 1. 1. 0.
Lev Distance - 28. 28. 30.
UBS 8. 7. 7. 8.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 2.
ILR 2. 2. 2. 2.
H 4. 3. 3. 4.
BL 2. 1. 2. 1.
BR 0. 1. 2. 2.
UN 0.152 0.269 0.240 0.162

Sequences

Field Description
UTR seq + 25 agguggcggagauugcaccggaagacgcuuccuggguuugaggaguucagugacugcuauugaaccaccaaaaguccauuATGAAACTGTATTGCCTGTCAGGGC
UTR dot + 25 .(((.(((…..))))))(((((…)))))((((((((..(.((((((((…..)))))))))..))))..))))……………((((….))))
RS 1 seq GGAUGACUCUCUGGAGAAGCUUACGAAAGGUGAGUGCCGAAGGUGAAAGCCGCCCGGAAAUCCGGGAUGGUGAAUCUCUCAGGCAAAAGGACAGGGAUACAAGA
RS 1 dot ……(((….)))..((((((…..))))))(((..(((.((..(((((((((….))))).))))…)))))..)))………………..
RS 2 seq GGACGGGACUCUGGAGAGACCCUGCAAAAGGGCGCCGAAGGGGCAAUGCGGAGAGCUUUACGCUGUCCGCUAAAUCUCUCAGGCAAAAGGACAGAGACGCACGG
RS 2 dot ….(((.(((….))).))).((……))(((..(((((….(((((.(((…..))).)))))….)))))..)))………………..
RS 3 seq GGAGGGGCCUCUGGAGAAUCCCGAUCGUCGGGUGCCGAAGGGGCAAGGCGAGUGACCAAGGGCCGCAUCGCCGAAACUCUCAGGCAAAAGGACAGAGCAAAGCUG
RS 3 dot ((((….))))…….(((((…)))))((((..((((….((((((((.((…)).))).)))))….))))..))))………(((…))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table