Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA053390 Similarity: 0.980 Similarity: 0.979 Similarity: 0.979
UTR: 5HSAA053390
Gene: INTU
MFE: -33.847
ENS: 0.512
Length: 95.
Predicted Ligands:
TPP - 9/20
tetrahydrofolate - 9/20
glycine - 2/20
 RS: URS0000D8DE07_1332264
MFE: -35.377
Ligand: TPP
Species: Tessaracoccus aquimaris TPP riboswitch (THI element)
 RS: URS0000BFD838_656366
MFE: -28.588
Ligand: TPP
Species: Arthrobacter sp. S6-3 TPP riboswitch (THI element)
 RS: URS0000C6FDBB_1423351
MFE: -24.097
Ligand: TPP
Species: Rhizoctonia solani 123E TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA053390 URS0000D8DE07_1332264 URS0000BFD838_656366 URS0000C6FDBB_1423351
Length 95. 95. 94. 97.
Similarity - 0.980 0.979 0.979
Ensemble Norm 0.512 - - -
MFE -33.847 -35.377 -28.588 -24.097
Ligands - TPP TPP TPP
Gene INTU - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8. 3.002 7.003
Length SE - 0. 1. 4.
Lev Distance - 24. 26. 21.
UBS 8. 9. 9. 9.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 1.
ILR 1. 3. 1. 2.
H 2. 1. 1. 1.
BL 3. 4. 3. 5.
BR 4. 5. 4. 4.
UN 0.042 0.021 0.085 0.093

Sequences

Field Description
UTR seq + 25 cauggcggccuuagcaagcuauagcugcgagauuugaauuacuccacucguagcuauugcauuccugacgATGGCCTCTGTGGCTTCGTGCGATT
UTR dot + 25 (((((.((((((((.((((.(((((((((((…((……..))))))))))))).)).)).))))….)))).)))))((…..))….
RS 1 seq UGGACGGCGCCGGGGUGCCCUACUGGAGGGCUGAGAUCACACCCGCAAUACCUGAUCUAGGUCGUGCUAGCGAAGGGAGCCCUGUGAACCAGGUC
RS 1 dot ..(((((..(((((((.((((.(((((.((((.((((((………….)))))).)))).).))))…)))).)))))).)..))..)))
RS 2 seq GGCAGUGACACGGGGUGCCCUUGGCGGGCUGAGAAAGACACCCGUUGAACCUGAUCUAGUUAGCACUAGCGAAGGGAUGUCCUGCCGGUUUCUU
RS 2 dot (((((.((((…..(.(((((.(((((((((…(((((………..)).)))..))))).)).)).)))))))))))))))……..
RS 3 seq CUUGAUGGCUGCGGGUAUCCGUCUCUGAUGGAUUGAGAAAUACCGCUUGAACCUGAUCAGUGUUGACACCUGCGUAGGGAAGCCCAAGUCUGAAAAU
RS 3 dot ((((..((((((((((.((.(.(.(((((((.(((((……..))))).))..))))).)).)).))))))…….))))))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table