Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA053453 Similarity: 0.963 Similarity: 0.960 Similarity: 0.958
UTR: 5HSAA053453
Gene: IPO11
MFE: -39.727
ENS: 0.912
Length: 155.
Predicted Ligands:
FMN - 10/20
TPP - 3/20
glycine - 2/20
 RS: URS0000D82FE6_1897634
MFE: -72.088
Ligand: FMN
Species: Tersicoccus sp. Bi-70 FMN riboswitch (RFN element)
 RS: URS0000D91B56_554083
MFE: -67.234
Ligand: FMN
Species: Arthrobacter sp. 1P05MA FMN riboswitch (RFN element)
 RS: URS0000DAA5C7_1930254
MFE: -52.944
Ligand: FMN
Species: Arthrobacter sp. SRS-W-1-2016 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA053453 URS0000D82FE6_1897634 URS0000D91B56_554083 URS0000DAA5C7_1930254
Length 155. 156. 153. 155.
Similarity - 0.963 0.960 0.958
Ensemble Norm 0.912 - - -
MFE -39.727 -72.088 -67.234 -52.944
Ligands - FMN FMN FMN
Gene IPO11 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 13.001 7. 8.001
Length SE - 1. 4. 0.
Lev Distance - 43. 45. 53.
UBS 10. 11. 11. 11.
BS 0. 0. 0. 0.
ILL 1. 3. 3. 3.
ILR 3. 3. 4. 4.
H 1. 1. 1. 1.
BL 2. 4. 3. 3.
BR 4. 2. 4. 5.
UN 0.039 0.006 0.026 0.013

Sequences

Field Description
UTR seq + 25 auagcaccaggugugaaacugcugggucauagaagauacagucacgaguugcuuaaggcugggauacauccugagaaaugggucguuaggcaauuuuguuguucuaugaacaucauaugaacaaaccuagATGGTACAGCCTATTATACACTTGG
UTR dot + 25 ……((((((((((((((((((((((((((((.(.(((…..(((((((((((((((((((….))))……..)))).))))))))))))))).))))))))…………….))))).))))……..)).)))))))))
RS 1 seq GUACGUGCUCCGGGGUCGGUGAAAUUCCGAACCGGCGGUCAAAGUCCGCGACCCGGUGCGUCGAUCCCGGUGGCUCAGCCACCGCGGGACGCGCAUCGGUUGAGCCGGUGGAAUUCCGGCACCGACAGUCACAGUCUGGAUGGGAGAAGCACGUCG
RS 1 dot (.(((((((((((((((((((.((((((..((((((..((((……….((((((((.((.((((((((((…))))))).))).))))))))))))))))))))))))))….)))))))……..))))))……..))))))).
RS 2 seq AUACGUGCUCCGGGGUCGGUGAAAGUCCGAACCGGCGGUGACAGUCCGCGACCCGGUGCGUCGAUCAGUGGCCACGCCACAGGAUCAGCGCACCGGUUGAGCCGGUGGAAUUCCGGCACCGACAGUCAGAGUCUGGAUGGGAGAAGCACGUCG
RS 2 dot ..(((((((((((((((((((…..((((((((.((((..(((……..(((((((((.((((.(((((…)))))..)))).)))))))))))).)))).)))..))).)))))))))……..))))))……..))))))..
RS 3 seq AUACGUGCUCCGGGGUCGGUGUAAUUCCGAACCGGCGGUUAUAGUCCGCGACCCGCGAGCCAUCGCGUUUCCCUCACGGGAUUCUCGACGGCGGACGGUUGAACUGGUGGAACUCCAGUACCGACAGUUAAAGUCUGGAUGGGAGAAGCACGUAC
RS 3 dot .((((((((((((((((((((……….(((.(((((((.((((((….((((((..(((.(((…….))).))).)))).)))))))).))..))))).)))……..)))))))……..))))))……..))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table