Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA053664 Similarity: 0.987 Similarity: 0.985 Similarity: 0.985
UTR: 5HSAA053664
Gene: IPP
MFE: -18.866
ENS: 0.928
Length: 75.
Predicted Ligands:
SAM - 6/20
guanidine - 5/20
fluoride - 3/20
 RS: URS00021EDBD1_12908
MFE: -21.599
Ligand: guanidine
Species: unclassified sequences guanidine-IV riboswitch
 RS: URS0000BED272_552398
MFE: -20.046
Ligand: fluoride
Species: Ruminococcaceae bacterium D16 Fluoride riboswitch
 RS: URS00021EDC51_12908
MFE: -28.549
Ligand: guanidine
Species: unclassified sequences guanidine-IV riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA053664 URS00021EDBD1_12908 URS0000BED272_552398 URS00021EDC51_12908
Length 75. 74. 75. 76.
Similarity - 0.987 0.985 0.985
Ensemble Norm 0.928 - - -
MFE -18.866 -21.599 -20.046 -28.549
Ligands - guanidine fluoride guanidine
Gene IPP - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11. 6.030 7.
Length SE - 1. 0. 1.
Lev Distance - 13. 18. 17.
UBS 4. 3. 5. 3.
BS 0. 0. 0. 0.
ILL 3. 0. 2. 1.
ILR 0. 0. 2. 1.
H 1. 1. 1. 1.
BL 0. 1. 0. 1.
BR 1. 1. 1. 1.
UN 0.240 0.243 0.067 0.237

Sequences

Field Description
UTR seq + 25 gguaguaacagauuaugggcaacaguccuuuuaauuaaucuaccgucaucATGGCTAATGAGGACTGTCCCAAGG
UTR dot + 25 ……………((((..(((((((((…((((…..((((….)))).)))))))))))))))))…
RS 1 seq AAAAAAUUACCGCCGGGUAGCGCUUUCUCAACUUCGUUAGGCCUUAGAAGAAGUGAGAAUAGCGUUAUUUUUUU
RS 1 dot …………..(((((((((((((((.(((((…………..)))))))))).))))))))))….
RS 2 seq CGCAAUAAAGGGAAUGAGGUCUCCCUUGUCCUUCGGGACUAAACCGCCUACAAGGCUGAUGGCUUCUGCGAUUUU
RS 2 dot ((((………..((((((((((((((….(((…….)))…))))))..)).))))))))))…..
RS 3 seq AAUAAAUUUCCGCCGGGAAACGCUUAUUUUUGCUCCGUUAGGCCAUUGCAGGAGUAAAAAUAAGCGUUUUGUUUUU
RS 3 dot …………..(.((((((((((((((((((((..(((….)))..)))))))))))))))))))).)….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table